EMAIL THIS PAGE TO A FRIEND

ITGAV

integrin, alpha V

211 Gene Product Result for
Synonyms: CD51 MSK8 VNRA VTNR
Gene ID:
Human(3685) Summary: This gene encodes a protein that is a member of the integrin superfamily. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein undergoes post-translational cleavage to yield disulfide-linked heavy and light chains that combine with multiple integrin beta chains to form different integrins. This protein has been shown to heterodimerize with beta 1, beta 3, beta 5, beta 6, and beta 8; the heterodimer of alpha v and beta 3 is the Vitronectin receptor. This protein interacts with several extracellular matrix proteins to mediate cell adhesion and may play a role in cell migration. It is proposed that this protein may regulate angiogenesis and cancer progression. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, May 2013]
Mouse(16410) integrin alpha V
Rat(296456) integrin, alpha V
sheep(443143) integrin, alpha V
Domestic Rabbit(100008956) integrin, alpha V
domestic guinea pig(100728575) integrin, alpha V
naked mole-rat(101717672) integrin, alpha V
Zebrafish(100151255) integrin, alpha V
cow(281875) integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51)
Horse(100068706) integrin, alpha V
domestic cat(101085820) integrin, alpha V
dog(488437) integrin, alpha V
chicken(396420) integrin, alpha V
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
G1269 Gly-Arg-Gly-Asp-Ser-Pro-Lys ≥97% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008402 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008402 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008402 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002210 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002210 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002210 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
MABT207 Anti-Integrin alpha-V Antibody, clone 272-17E6 (Azide free) Anti-Integrin alpha-V Antibody, clone 272-17E6 (Azide free) detects level of Integrin alpha-V & has been published & validated for use in Flow Cytometry, Immunoprecipitation, Activity Assay. pricing
AB1930 Anti-Integrin alphaV Antibody, CT, Intracellular Anti-Integrin alphaV Antibody, C-terminus, Intracellular detects level of Integrin alphaV & has been published & validated for use in ELISA, IH, IP, RIA & WB. pricing
CBL544 Anti-Integrin αVβ3 Antibody, clone 23C6 Detect Integrin αVβ3 using this Anti-Integrin αVβ3 Antibody, clone 23C6 validated for use in FC & IP. pricing
MAB1876 Anti-Integrin αVβ3 Antibody, clone 27.1 (VNR-1) Anti-Integrin αVβ3 Antibody, clone 27.1 (VNR-1) detects level of Integrin αVβ3 & has been published & validated for use in IF & IP. pricing
MAB1976 Anti-Integrin αVβ3 Antibody, clone LM609 Anti-Integrin αVβ3 Antibody, clone LM609 is an antibody against Integrin αVβ3 for use in FC, IF, IH and IP and has published in over 60 citations. pricing
MAB1976X Anti-Integrin αVβ3 Antibody, clone LM609, Alexa Fluor®488 conjugated This Anti-Integrin αVβ3 Antibody, clone LM609, Alexa Fluor®488 conjugated is validated for use in FC, IF for the detection of Integrin αVβ3. pricing
MAB1976-AF555 Anti-Integrin αVβ3 Antibody, clone LM609, Alexa Fluor® 555 Conjugate Anti-Integrin αVβ3 Antibody, clone LM609, Alexa Fluor® 555 Conjugate is an antibody against Integrin αVβ3 for use in Immunocytochemistry. pricing
MAB1976Z Anti-Integrin αVβ3 Antibody, clone LM609, Azide Free This Anti-Integrin αVβ3 Antibody, clone LM609, Azide Free is validated for use in FC, IH, IP, FUNC for the detection of Integrin αVβ3. pricing
MAB1976B Anti-Integrin αVβ3 Antibody, clone LM609, biotin conjugated Detect Integrin αVβ3 using this Anti-Integrin αVβ3 Antibody, clone LM609, biotin conjugated validated for use in FC, IH & IP. pricing
MAB1976F Anti-Integrin αVβ3 Antibody, clone LM609, FITC conjugated Anti-Integrin αVβ3 Antibody, clone LM609, FITC conjugated detects level of Integrin αVβ3 & has been published & validated for use in FC, IH. pricing
MAB1976H Anti-Integrin αVβ3 Antibody, clone LM609, Phycoerythrin conjugated Anti-Integrin αVβ3 Antibody, clone LM609, Phycoerythrin conjugated detects level of Integrin αVβ3 & has been published & validated for use in FC, IH. pricing
MAB2019Z Anti-Integrin αVβ5 Antibody, clone 15F11, Azide Free Anti-Integrin αVβ5 Antibody, clone 15F11, Azide Free is an antibody against Integrin αVβ5 for use in ELISA, FC, IP & IC. pricing
MAB1961 Anti-Integrin αVβ5 Antibody, clone P1F6 This Anti-Integrin αVβ5 Antibody, clone P1F6 is validated for use in FC, IC, IH, IP, FUNC for the detection of Integrin αVβ5. pricing
MAB1961X Anti-Integrin αVβ5 Antibody, clone P1F6, Alexa Fluor® 488 conjugated Anti-Integrin αVβ5 Antibody, clone P1F6, Alexa Fluor 488 conjugated is an antibody against Integrin αVβ5 for use in FC & IF. pricing
MAB1961Z Anti-Integrin αVβ5 Antibody, clone P1F6, azide free Detect Integrin αVβ5 using this Anti-Integrin αVβ5 Antibody, clone P1F6, azide free validated for use in FC, IH. pricing
MAB1961F Anti-Integrin αVβ5 Antibody, clone P1F6, FITC conjugated Anti-Integrin αVβ5 Antibody, clone P1F6, FITC conjugated detects level of Integrin αVβ5 & has been published & validated for use in FC, IF, IH. pricing
MAB1961H-I Anti-Integrin αVβ5 Antibody, clone P1F6, Phycoerythrin conjugate Anti-Integrin αVβ5 Antibody, clone P1F6, Phycoerythrin conjugate is an antibody against Integrin αVβ5 for use in Flow Cytometry. pricing
MAB2077Z Anti-Integrin αVβ6 Antibody, clone 10D5, azide free Anti-Integrin αVβ6 Antibody, clone 10D5, azide free is an antibody against Integrin αVβ6 for use in FC & IP. pricing
MAB2074Z Anti-Integrin αVβ6 Antibody, clone E7P6, azide free This Anti-Integrin αVβ6 Antibody, clone E7P6, azide free is validated for use in FC, IC, IH for the detection of Integrin αVβ6. pricing
CBL490 Anti-Integrin αV Antibody, clone 13C2 Anti-Integrin αV Antibody, clone 13C2 is an antibody against Integrin αV for use in FC, IH. pricing
CBL490P Anti-Integrin αV Antibody, clone 13C2, Phycoerythrin conjugated Detect Integrin αV using this Anti-Integrin αV Antibody, clone 13C2, Phycoerythrin conjugated validated for use in FC. pricing
MAB1978 Anti-Integrin αV Antibody, clone LM142 Detect Integrin αV using this Anti-Integrin αV Antibody, clone LM142 validated for use in IP, IH. pricing
MAB1980 Anti-Integrin αV Antibody, clone M9 Anti-Integrin αV Antibody, clone M9 detects level of Integrin αV & has been published & validated for use in FC & IH. pricing
MAB1953 Anti-Integrin αV Antibody, clone P3G8 Anti-Integrin αV Antibody, clone P3G8 is an antibody against Integrin αV for use in ELISA, FC, IP, IC, IH. pricing
MAB1953Z Anti-Integrin αV Antibody, clone P3G8, azide free This Anti-Integrin αV Antibody, clone P3G8, azide free is validated for use in ELISA, FC, IP, IC, IH for the detection of Integrin αV. pricing
AB1923 Anti-Integrin αV Antibody, cytoplasmic domain Anti-Integrin αV Antibody, cytoplasmic domain detects level of Integrin αV & has been published & validated for use in ELISA & WB. pricing
MAB2021Z Anti-Integrin αV Antibody, extracellular, clone AV1, azide free Anti-Integrin αV Antibody, extracellular, clone AV1, azide free detects level of Integrin αV & has been published & validated for use in FC & WB. pricing
CBL1346Z-I Anti-mouse Integrin alphaV Antibody, clone RMV-7 (Preservative free) This Anti-mouse Integrin alphaV Antibody, clone RMV-7 (Preservative free) is validated for use in Western Blotting, Immunoprecipitation, Flow Cytometry for the detection of mouse Integrin alphaV. pricing
CC102A Human Integrin αVβ3, Octyl-β-D-glucopyranoside Formulation pricing
CC101 Human Integrin αVβ3 Protein, Triton X-100 Formulation pricing
CC102B Human Integrin αVβ5, Octyl-β-D-glucopyranoside Formulation pricing
CC102C Human Integrin αVβ5 Protein, Triton X-100 Formulation pricing
FCMAB282F Milli-Mark™ Anti-Integrin αVβ3 Antibody, clone LM609-FITC Detect Integrin αVβ3 using this Milli-Mark Anti-Integrin αVβ3 Antibody, clone LM609-FITC validated for use in FC. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002210 Rosetta Predictions human pricing
NM_001106549 Rosetta Predictions rat pricing
NM_008402 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002210 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220507 predicted 3502
2 SASI_Hs01_00220508 predicted 3185
3 SASI_Hs01_00220509 predicted 2223
4 SASI_Hs02_00333436 predicted 1633
5 SASI_Hs01_00220510 predicted 595
6 SASI_Hs01_00220511 predicted 554
7 SASI_Hs01_00220512 predicted 1336
8 SASI_Hs01_00220513 predicted 1319
9 SASI_Hs01_00220514 predicted 2523
10 SASI_Hs01_00220515 predicted 3002
11 SASI_Hs01_00220516 predicted 1348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106549 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220048 predicted 1393
2 SASI_Rn02_00220049 predicted 1448
3 SASI_Rn02_00220050 predicted 559
4 SASI_Rn02_00220051 predicted 1362
5 SASI_Rn02_00220052 predicted 508
6 SASI_Rn02_00220053 predicted 1049
7 SASI_Rn02_00220054 predicted 1563
8 SASI_Rn02_00220055 predicted 1105
9 SASI_Rn02_00220056 predicted 545
10 SASI_Rn02_00220057 predicted 1630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008402 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313839 predicted 1908
2 SASI_Mm01_00141376 predicted 1574
3 SASI_Mm01_00141377 predicted 1688
4 SASI_Mm01_00141378 predicted 636
5 SASI_Mm01_00141379 predicted 2647
6 SASI_Mm01_00141380 predicted 2741
7 SASI_Mm02_00313840 predicted 1543
8 SASI_Mm01_00141381 predicted 2070
9 SASI_Mm01_00141383 predicted 1076
10 SASI_Mm02_00313841 predicted 1526
11 SASI_Mm01_00141374 predicted 568
12 SASI_Mm01_00141375 predicted 1802
13 SASI_Mm01_00141382 predicted 2466
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008402
VALIDATED
ITGAV MISSION shRNA Bacterial Glycerol Stock
integrin, alpha V
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008402.2-2666s21c1
Sequence:CCGGAGTTTCAAGTCCAGATCATATCTCGAGATATGATCTGGACTTGAAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008402.2-1768s21c1
Sequence:CCGGTTGAAGTGTACCCTAGCATTTCTCGAGAAATGCTAGGGTACACTTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008402.2-3828s21c1
Sequence:CCGGGACGTTACGTTAGGGCAATTACTCGAGTAATTGCCCTAACGTAACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066588    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008402.1-3559s1c1
Sequence:CCGGCGTGTGTTCTTAGGGACTTAACTCGAGTTAAGTCCCTAAGAACACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008402.1-2707s1c1
Sequence:CCGGGCCTTACAAATACAACAACAACTCGAGTTGTTGTTGTATTTGTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008402.1-352s1c1
Sequence:CCGGCGAGGGAAGTTACTTCGGATTCTCGAGAATCCGAAGTAACTTCCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008402.1-1541s1c1
Sequence:CCGGGCTACAGATGTAGACAGGAATCTCGAGATTCCTGTCTACATCTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008402.1-510s1c1
Sequence:CCGGGCCAGCCCATTGAGTTTGATTCTCGAGAATCAAACTCAATGGGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008402
VALIDATED
ITGAV MISSION shRNA shRNA Plasmid DNA
integrin, alpha V
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008402.2-2666s21c1
Sequence:CCGGAGTTTCAAGTCCAGATCATATCTCGAGATATGATCTGGACTTGAAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008402.2-1768s21c1
Sequence:CCGGTTGAAGTGTACCCTAGCATTTCTCGAGAAATGCTAGGGTACACTTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008402.2-3828s21c1
Sequence:CCGGGACGTTACGTTAGGGCAATTACTCGAGTAATTGCCCTAACGTAACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066588    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008402.1-3559s1c1
Sequence:CCGGCGTGTGTTCTTAGGGACTTAACTCGAGTTAAGTCCCTAAGAACACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008402.1-2707s1c1
Sequence:CCGGGCCTTACAAATACAACAACAACTCGAGTTGTTGTTGTATTTGTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008402.1-352s1c1
Sequence:CCGGCGAGGGAAGTTACTTCGGATTCTCGAGAATCCGAAGTAACTTCCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008402.1-1541s1c1
Sequence:CCGGGCTACAGATGTAGACAGGAATCTCGAGATTCCTGTCTACATCTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008402.1-510s1c1
Sequence:CCGGGCCAGCCCATTGAGTTTGATTCTCGAGAATCAAACTCAATGGGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008402
VALIDATED
ITGAV MISSION shRNA Lentiviral Transduction Particles
integrin, alpha V
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008402.2-2666s21c1
Sequence:CCGGAGTTTCAAGTCCAGATCATATCTCGAGATATGATCTGGACTTGAAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008402.2-1768s21c1
Sequence:CCGGTTGAAGTGTACCCTAGCATTTCTCGAGAAATGCTAGGGTACACTTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008402.2-3828s21c1
Sequence:CCGGGACGTTACGTTAGGGCAATTACTCGAGTAATTGCCCTAACGTAACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066588    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008402.1-3559s1c1
Sequence:CCGGCGTGTGTTCTTAGGGACTTAACTCGAGTTAAGTCCCTAAGAACACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008402.1-2707s1c1
Sequence:CCGGGCCTTACAAATACAACAACAACTCGAGTTGTTGTTGTATTTGTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008402.1-352s1c1
Sequence:CCGGCGAGGGAAGTTACTTCGGATTCTCGAGAATCCGAAGTAACTTCCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008402.1-1541s1c1
Sequence:CCGGGCTACAGATGTAGACAGGAATCTCGAGATTCCTGTCTACATCTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008402.1-510s1c1
Sequence:CCGGGCCAGCCCATTGAGTTTGATTCTCGAGAATCAAACTCAATGGGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002210
VALIDATED
ITGAV MISSION shRNA Bacterial Glycerol Stock
integrin, alpha V
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002210.2-5024s21c1
Sequence:CCGGGACTGAGCTAATCTTGAGAATCTCGAGATTCTCAAGATTAGCTCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002210.2-2776s21c1
Sequence:CCGGCTCTGTTGTATATCCTTCATTCTCGAGAATGAAGGATATACAACAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002210.2-648s21c1
Sequence:CCGGGTGAGGTCGAAACAGGATAAACTCGAGTTTATCCTGTTTCGACCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002210.3-2128s21c1
Sequence:CCGGCGACAGGCTCACATTCTACTTCTCGAGAAGTAGAATGTGAGCCTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002210.x-1893s1c1
Sequence:CCGGCGACAGGCTCACATTCTACTTCTCGAGAAGTAGAATGTGAGCCTGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002210.x-423s1c1
Sequence:CCGGGTGAGGTCGAAACAGGATAAACTCGAGTTTATCCTGTTTCGACCTCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002210.x-4799s1c1
Sequence:CCGGGACTGAGCTAATCTTGAGAATCTCGAGATTCTCAAGATTAGCTCAGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002210.x-2551s1c1
Sequence:CCGGCTCTGTTGTATATCCTTCATTCTCGAGAATGAAGGATATACAACAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002210.x-1692s1c1
Sequence:CCGGCACTCCAAGAACATGACTATTCTCGAGAATAGTCATGTTCTTGGAGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002210
VALIDATED
ITGAV MISSION shRNA shRNA Plasmid DNA
integrin, alpha V
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002210.2-5024s21c1
Sequence:CCGGGACTGAGCTAATCTTGAGAATCTCGAGATTCTCAAGATTAGCTCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002210.2-2776s21c1
Sequence:CCGGCTCTGTTGTATATCCTTCATTCTCGAGAATGAAGGATATACAACAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002210.2-648s21c1
Sequence:CCGGGTGAGGTCGAAACAGGATAAACTCGAGTTTATCCTGTTTCGACCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002210.3-2128s21c1
Sequence:CCGGCGACAGGCTCACATTCTACTTCTCGAGAAGTAGAATGTGAGCCTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002210.x-1893s1c1
Sequence:CCGGCGACAGGCTCACATTCTACTTCTCGAGAAGTAGAATGTGAGCCTGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002210.x-423s1c1
Sequence:CCGGGTGAGGTCGAAACAGGATAAACTCGAGTTTATCCTGTTTCGACCTCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002210.x-4799s1c1
Sequence:CCGGGACTGAGCTAATCTTGAGAATCTCGAGATTCTCAAGATTAGCTCAGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002210.x-2551s1c1
Sequence:CCGGCTCTGTTGTATATCCTTCATTCTCGAGAATGAAGGATATACAACAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002210.x-1692s1c1
Sequence:CCGGCACTCCAAGAACATGACTATTCTCGAGAATAGTCATGTTCTTGGAGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002210
VALIDATED
ITGAV MISSION shRNA Lentiviral Transduction Particles
integrin, alpha V
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002210.2-5024s21c1
Sequence:CCGGGACTGAGCTAATCTTGAGAATCTCGAGATTCTCAAGATTAGCTCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002210.2-2776s21c1
Sequence:CCGGCTCTGTTGTATATCCTTCATTCTCGAGAATGAAGGATATACAACAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002210.2-648s21c1
Sequence:CCGGGTGAGGTCGAAACAGGATAAACTCGAGTTTATCCTGTTTCGACCTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002210.3-2128s21c1
Sequence:CCGGCGACAGGCTCACATTCTACTTCTCGAGAAGTAGAATGTGAGCCTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002210.x-1893s1c1
Sequence:CCGGCGACAGGCTCACATTCTACTTCTCGAGAAGTAGAATGTGAGCCTGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002210.x-423s1c1
Sequence:CCGGGTGAGGTCGAAACAGGATAAACTCGAGTTTATCCTGTTTCGACCTCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002210.x-4799s1c1
Sequence:CCGGGACTGAGCTAATCTTGAGAATCTCGAGATTCTCAAGATTAGCTCAGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002210.x-2551s1c1
Sequence:CCGGCTCTGTTGTATATCCTTCATTCTCGAGAATGAAGGATATACAACAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002210.x-1692s1c1
Sequence:CCGGCACTCCAAGAACATGACTATTCTCGAGAATAGTCATGTTCTTGGAGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)