EMAIL THIS PAGE TO A FRIEND

ITGAX

integrin, alpha X (complement component 3 receptor 4 subunit)

121 Gene Product Result for
Synonyms: CD11C SLEB6
UniProtKB ID: P20702, Q8IVA6
Gene ID:
Human(3687) Summary: This gene encodes the integrin alpha X chain protein. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as inactivated-C3b (iC3b) receptor 4 (CR4). The alpha X beta 2 complex seems to overlap the properties of the alpha M beta 2 integrin in the adherence of neutrophils and monocytes to stimulated endothelium cells, and in the phagocytosis of complement coated particles. [provided by RefSeq, Jul 2008]
Mouse(16411) integrin alpha X
Rat(499271) integrin, alpha X
dog(489929) integrin, alpha X (complement component 3 receptor 4 subunit)
domestic cat(101087698) integrin, alpha X (complement component 3 receptor 4 subunit)
cow(100298252) integrin, alpha X (complement component 3 receptor 4 subunit)
cow(101904707) integrin, alpha X (complement component 3 receptor 4 subunit)
Horse(100064779) integrin, alpha X (complement component 3 receptor 4 subunit)
domestic guinea pig(100735416) integrin, alpha X (complement component 3 receptor 4 subunit)
naked mole-rat(101718732) integrin, alpha X (complement component 3 receptor 4 subunit)
sheep(101106739) integrin, alpha X (complement component 3 receptor 4 subunit)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021334 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021334 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021334 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000887 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000887 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000887 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU072691 MISSION® esiRNA esiRNA human ITGAX (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
MABF521 Anti-CD11c Antibody (human), APC, clone 3.9 This mouse monoclonal antibody Anti-CD11c (human), APC & clone 3.9 validated for use in IP;Immunofluorescence;Flow Cytometry for the detection of CD11c. pricing
MABF522 Anti-CD11c Antibody (human), PE, clone 3.9 This mouse monoclonal antibody Anti-CD11c (human), PE, clone 3.9 validated for use in IP, Immunofluorescence & Flow Cytometry for the detection of CD11c. pricing
MABF523 Anti-CD11c Antibody (human), PE-Cy7, clone 3.9 This mouse monoclonal antibody Anti-CD11c (human), PE-Cy7, clone 3.9 validated for use in IP, Immunofluorescence & Flow Cytometry for the detection of CD11c. pricing
MABF371 Anti-CD11c Antibody (mouse), APC, clone N418 This Armenian Hamster Monoclonal Antibody Anti-CD11c (mouse), APC, clone N418, Cat. No. MABF371 is validated for use in IP, IHC, IF, FC for the detection of CD11c. pricing
MABF526 Anti-CD11c Antibody (mouse), APC, clone N418 This armenian hamster monoclonal antibody Anti-CD11c (mouse), APC & clone N418 validated for use in IP;IHC;Immunofluorescence;Flow Cytometry for the detection of CD11c. pricing
MABF527 Anti-CD11c Antibody (mouse), APC-Cy7, clone N418 This armenian hamster monoclonal antibody Anti-CD11c (mouse), APC-Cy7, clone N418 validated for use in IP, IHC, Immunofluorescence & Flow Cytometry for the detection of CD11c. pricing
MABF373 Anti-CD11c Antibody (mouse), Biotin, clone N418 This armenian hamster monoclonal antibody Anti-CD11c (mouse), Biotin, clone N418 validated for use in IP, IHC, Immunofluorescence & Flow Cytometry for the detection of CD11c. pricing
MABF528 Anti-CD11c Antibody (mouse), Biotin, clone N418 This armenian hamster monoclonal antibody Anti-CD11c (mouse), Biotin, clone N418 validated for use in IP, IHC, Immunofluorescence & Flow Cytometry for the detection of CD11c. pricing
MABF529 Anti-CD11c Antibody (mouse), Biotin, clone N418 This armenian hamster monoclonal antibody Anti-CD11c (mouse), Biotin, clone N418 validated for use in IP, IHC, Immunofluorescence & Flow Cytometry for the detection of CD11c. pricing
MABF374 Anti-CD11c Antibody (mouse), FITC, clone N418 This armenian hamster monoclonal antibody Anti-CD11c (mouse), FITC, clone N418 validated for use in IP, IHC, Immunofluorescence & Flow Cytometry for the detection of CD11c. pricing
MABF530 Anti-CD11c Antibody (mouse), FITC, clone N418 This armenian hamster monoclonal antibody Anti-CD11c (mouse), FITC, clone N418 validated for use in IP, IHC, Immunofluorescence & Flow Cytometry for the detection of CD11c. pricing
MABF531 Anti-CD11c Antibody (mouse), FITC, clone N418 This armenian hamster monoclonal antibody Anti-CD11c (mouse), FITC, clone N418 validated for use in IP, IHC, Immunofluorescence & Flow Cytometry for the detection of CD11c. pricing
MABF375 Anti-CD11c Antibody (mouse), PE, clone N418 This armenian hamster monoclonal antibody Anti-CD11c (mouse), PE, clone N418 validated for use in IP, IHC, Immunofluorescence & Flow Cytometry for the detection of CD11c. pricing
MABF532 Anti-CD11c Antibody (mouse), PE, clone N418 This armenian hamster monoclonal antibody Anti-CD11c (mouse), PE, clone N418 validated for use in IP, IHC, Immunofluorescence & Flow Cytometry for the detection of CD11c. pricing
MABF376 Anti-CD11c Antibody (mouse), PE-Cy7, clone N418 This armenian hamster monoclonal antibody Anti-CD11c (mouse), PE-Cy7, clone N418 validated for use in IP, IHC, Immunofluorescence & Flow Cytometry for the detection of CD11c. pricing
MABF533 Anti-CD11c Antibody (mouse), PE-Cy7, clone N418 This armenian hamster monoclonal antibody Anti-CD11c (mouse), PE-Cy7, clone N418 validated for use in IP, IHC, Immunofluorescence & Flow Cytometry for the detection of CD11c. pricing
MABF377 Anti-CD11c Antibody (mouse), PerCP-Cy5.5, clone N418 This armenian hamster monoclonal antibody Anti-CD11c (mouse), PerCP-Cy5.5, clone N418 validated for use in IP, IHC, Immunofluorescence & Flow Cytometry for the detection of CD11c. pricing
MABF534 Anti-CD11c Antibody (mouse), PerCP-Cy5.5, clone N418 This armenian hamster monoclonal antibody Anti-CD11c (mouse), PerCP-Cy5.5, clone N418 validated for use in IP, IHC, Immunofluorescence & Flow Cytometry for the detection of CD11c. pricing
MABF524 Anti-CD11c Antibody (mouse), violetFluor™ 450, clone N418 This armenian hamster monoclonal antibody Anti-CD11c (mouse), violetFluor 450, clone N418 validated for use in IP, IHC, Immunofluorescence & Flow Cytometry for the detection of CD11c. pricing
MABF525 Anti-CD11c Antibody (mouse), violetFluor™ 450, clone N418 This armenian hamster monoclonal antibody Anti-CD11c (mouse), violetFluor 450, clone N418 validated for use in IP, IHC, Immunofluorescence & Flow Cytometry for the detection of CD11c. pricing
MABF161D Anti-CD11c (human), redFluor™ 710, clone 3.9 Antibody This mouse monoclonal Anti-CD11c Antibody (human), redFluor™ 710, clone 3.9, Cat. No. MABF1616 is validated for use in Flow Cytometry, for the detection of CD11c. pricing
MABF161C Anti-CD11c (human), violetFluor™ 450, clone 3.9 Antibody This mouse monoclonal Anti-CD11c Antibody (human), violetFluor™ 450, clone 3.9, Cat. No. MABF1614 is validated for use in Flow Cytometry, for the detection of CD11c. pricing
MABF150A Anti-CD11c (Mouse), redFluor™ 710, clone N418 Antibody Anti-CD11c (Mouse), redFluor™ 710, clone N418 Antibody detects level of CD11c and has been published and validated for use in Flow Cytometry. pricing
MAB1399Z Anti-Integrin αX Antibody, clone N418, azide free Anti-Integrin αX Antibody, clone N418, azide free is an antibody against Integrin αX for use in FC, IH. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000887 Rosetta Predictions human pricing
XM_001080404 Rosetta Predictions rat pricing
XM_574569 Rosetta Predictions rat pricing
NM_021334 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000887 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240306 predicted 646
2 SASI_Hs01_00240307 predicted 661
3 SASI_Hs01_00240308 predicted 2387
4 SASI_Hs01_00240309 predicted 3077
5 SASI_Hs01_00240311 predicted 2029
6 SASI_Hs01_00240312 predicted 672
7 SASI_Hs02_00303434 predicted 555
8 SASI_Hs01_00240313 predicted 1104
9 SASI_Hs02_00303435 predicted 226
10 SASI_Hs02_00303436 predicted 3456
11 SASI_Hs01_00240310 predicted 3327
12 SASI_Hs01_00240314 predicted 1235
13 SASI_Hs01_00240315 predicted 1276
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080404 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367889 predicted 2718
2 SASI_Rn02_00367890 predicted 621
3 SASI_Rn02_00367891 predicted 888
4 SASI_Rn02_00367892 predicted 2812
5 SASI_Rn02_00367893 predicted 1047
6 SASI_Rn02_00367894 predicted 350
7 SASI_Rn02_00367895 predicted 2181
8 SASI_Rn02_00367896 predicted 2898
9 SASI_Rn02_00367897 predicted 2872
10 SASI_Rn02_00367898 predicted 678
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574569 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402202 predicted 564
2 SASI_Rn02_00402203 predicted 618
3 SASI_Rn02_00402204 predicted 894
4 SASI_Rn02_00402205 predicted 1047
5 SASI_Rn02_00402206 predicted 349
6 SASI_Rn02_00402207 predicted 600
7 SASI_Rn02_00402208 predicted 943
8 SASI_Rn02_00402209 predicted 677
9 SASI_Rn02_00402210 predicted 508
10 SASI_Rn02_00402211 predicted 911
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021334 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020972 predicted 3514
2 SASI_Mm01_00020973 predicted 722
3 SASI_Mm01_00020974 predicted 2072
4 SASI_Mm01_00020975 predicted 685
5 SASI_Mm01_00020977 predicted 628
6 SASI_Mm02_00325910 predicted 847
7 SASI_Mm01_00020978 predicted 745
8 SASI_Mm01_00020979 predicted 258
9 SASI_Mm01_00020980 predicted 229
10 SASI_Mm02_00325911 predicted 710
11 SASI_Mm01_00020976 predicted 3647
12 SASI_Mm01_00020981 predicted 2551
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021334
ITGAX MISSION shRNA Bacterial Glycerol Stock
integrin, alpha X (complement component 3 receptor 4 subunit)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021334.1-2179s1c1
Sequence:CCGGGCACTGTGAAAGTGTGAAGTTCTCGAGAACTTCACACTTTCACAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021334.1-391s1c1
Sequence:CCGGCCACACATGCAGAGAGAATATCTCGAGATATTCTCTCTGCATGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021334.1-887s1c1
Sequence:CCGGGCTGCAAGCATCATTCGTTATCTCGAGATAACGAATGATGCTTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021334.1-3436s1c1
Sequence:CCGGGCTGGCTATCATCACAGCTATCTCGAGATAGCTGTGATGATAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021334.1-754s1c1
Sequence:CCGGGCATGTCATAACAGAACTGTTCTCGAGAACAGTTCTGTTATGACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000453367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021334.2-2874s21c1
Sequence:CCGGATGACCAGTTTACCAAGTATCCTCGAGGATACTTGGTAAACTGGTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000453753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021334.2-2384s21c1
Sequence:CCGGGATGACCTTAGTGTCGTATTTCTCGAGAAATACGACACTAAGGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000451906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021334.2-2456s21c1
Sequence:CCGGGTAGATGTGACGGTGTCTAATCTCGAGATTAGACACCGTCACATCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021334.2-2923s21c1
Sequence:CCGGGACCAGTGTGGTCGAACATAGCTCGAGCTATGTTCGACCACACTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021334
ITGAX MISSION shRNA shRNA Plasmid DNA
integrin, alpha X (complement component 3 receptor 4 subunit)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021334.1-2179s1c1
Sequence:CCGGGCACTGTGAAAGTGTGAAGTTCTCGAGAACTTCACACTTTCACAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021334.1-391s1c1
Sequence:CCGGCCACACATGCAGAGAGAATATCTCGAGATATTCTCTCTGCATGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021334.1-887s1c1
Sequence:CCGGGCTGCAAGCATCATTCGTTATCTCGAGATAACGAATGATGCTTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021334.1-3436s1c1
Sequence:CCGGGCTGGCTATCATCACAGCTATCTCGAGATAGCTGTGATGATAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021334.1-754s1c1
Sequence:CCGGGCATGTCATAACAGAACTGTTCTCGAGAACAGTTCTGTTATGACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000453367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021334.2-2874s21c1
Sequence:CCGGATGACCAGTTTACCAAGTATCCTCGAGGATACTTGGTAAACTGGTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000453753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021334.2-2384s21c1
Sequence:CCGGGATGACCTTAGTGTCGTATTTCTCGAGAAATACGACACTAAGGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000451906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021334.2-2456s21c1
Sequence:CCGGGTAGATGTGACGGTGTCTAATCTCGAGATTAGACACCGTCACATCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021334.2-2923s21c1
Sequence:CCGGGACCAGTGTGGTCGAACATAGCTCGAGCTATGTTCGACCACACTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021334
ITGAX MISSION shRNA Lentiviral Transduction Particles
integrin, alpha X (complement component 3 receptor 4 subunit)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021334.1-2179s1c1
Sequence:CCGGGCACTGTGAAAGTGTGAAGTTCTCGAGAACTTCACACTTTCACAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021334.1-391s1c1
Sequence:CCGGCCACACATGCAGAGAGAATATCTCGAGATATTCTCTCTGCATGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021334.1-887s1c1
Sequence:CCGGGCTGCAAGCATCATTCGTTATCTCGAGATAACGAATGATGCTTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021334.1-3436s1c1
Sequence:CCGGGCTGGCTATCATCACAGCTATCTCGAGATAGCTGTGATGATAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021334.1-754s1c1
Sequence:CCGGGCATGTCATAACAGAACTGTTCTCGAGAACAGTTCTGTTATGACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000453367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021334.2-2874s21c1
Sequence:CCGGATGACCAGTTTACCAAGTATCCTCGAGGATACTTGGTAAACTGGTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000453753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021334.2-2384s21c1
Sequence:CCGGGATGACCTTAGTGTCGTATTTCTCGAGAAATACGACACTAAGGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000451906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021334.2-2456s21c1
Sequence:CCGGGTAGATGTGACGGTGTCTAATCTCGAGATTAGACACCGTCACATCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021334.2-2923s21c1
Sequence:CCGGGACCAGTGTGGTCGAACATAGCTCGAGCTATGTTCGACCACACTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000887
ITGAX MISSION shRNA Bacterial Glycerol Stock
integrin, alpha X (complement component 3 receptor 4 subunit)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029044    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000887.3-3859s1c1
Sequence:CCGGCGAATGATCTTTCTTTCCTTTCTCGAGAAAGGAAAGAAAGATCATTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000887.3-2856s1c1
Sequence:CCGGGCCACGAACAATTCACCAAATCTCGAGATTTGGTGAATTGTTCGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000887.3-3469s1c1
Sequence:CCGGGCGTCAGTACAAGGAAATGATCTCGAGATCATTTCCTTGTACTGACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000887.3-2031s1c1
Sequence:CCGGGCCTTTACATTGACAAACGTTCTCGAGAACGTTTGTCAATGTAAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000887.3-1216s1c1
Sequence:CCGGCCCAAATATGAGCCCTACCTTCTCGAGAAGGTAGGGCTCATATTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000887.3-779s21c1
Sequence:CCGGCGATTGTTCCATGCCTCATATCTCGAGATATGAGGCATGGAACAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000887.3-1094s21c1
Sequence:CCGGAGCAGTAGCTCCTTCGAATTGCTCGAGCAATTCGAAGGAGCTACTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000887.3-636s21c1
Sequence:CCGGTGATGCAGTTCTCCAACAAATCTCGAGATTTGTTGGAGAACTGCATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000887.3-856s21c1
Sequence:CCGGAGGCGACAGCCTGGATTATAACTCGAGTTATAATCCAGGCTGTCGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000887
ITGAX MISSION shRNA shRNA Plasmid DNA
integrin, alpha X (complement component 3 receptor 4 subunit)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029044    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000887.3-3859s1c1
Sequence:CCGGCGAATGATCTTTCTTTCCTTTCTCGAGAAAGGAAAGAAAGATCATTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000887.3-2856s1c1
Sequence:CCGGGCCACGAACAATTCACCAAATCTCGAGATTTGGTGAATTGTTCGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000887.3-3469s1c1
Sequence:CCGGGCGTCAGTACAAGGAAATGATCTCGAGATCATTTCCTTGTACTGACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000887.3-2031s1c1
Sequence:CCGGGCCTTTACATTGACAAACGTTCTCGAGAACGTTTGTCAATGTAAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000887.3-1216s1c1
Sequence:CCGGCCCAAATATGAGCCCTACCTTCTCGAGAAGGTAGGGCTCATATTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000887.3-779s21c1
Sequence:CCGGCGATTGTTCCATGCCTCATATCTCGAGATATGAGGCATGGAACAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000887.3-1094s21c1
Sequence:CCGGAGCAGTAGCTCCTTCGAATTGCTCGAGCAATTCGAAGGAGCTACTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000887.3-636s21c1
Sequence:CCGGTGATGCAGTTCTCCAACAAATCTCGAGATTTGTTGGAGAACTGCATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000887.3-856s21c1
Sequence:CCGGAGGCGACAGCCTGGATTATAACTCGAGTTATAATCCAGGCTGTCGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000887
ITGAX MISSION shRNA Lentiviral Transduction Particles
integrin, alpha X (complement component 3 receptor 4 subunit)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029044    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000887.3-3859s1c1
Sequence:CCGGCGAATGATCTTTCTTTCCTTTCTCGAGAAAGGAAAGAAAGATCATTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000887.3-2856s1c1
Sequence:CCGGGCCACGAACAATTCACCAAATCTCGAGATTTGGTGAATTGTTCGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000887.3-3469s1c1
Sequence:CCGGGCGTCAGTACAAGGAAATGATCTCGAGATCATTTCCTTGTACTGACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000887.3-2031s1c1
Sequence:CCGGGCCTTTACATTGACAAACGTTCTCGAGAACGTTTGTCAATGTAAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000887.3-1216s1c1
Sequence:CCGGCCCAAATATGAGCCCTACCTTCTCGAGAAGGTAGGGCTCATATTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000887.3-779s21c1
Sequence:CCGGCGATTGTTCCATGCCTCATATCTCGAGATATGAGGCATGGAACAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000887.3-1094s21c1
Sequence:CCGGAGCAGTAGCTCCTTCGAATTGCTCGAGCAATTCGAAGGAGCTACTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000887.3-636s21c1
Sequence:CCGGTGATGCAGTTCTCCAACAAATCTCGAGATTTGTTGGAGAACTGCATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000887.3-856s21c1
Sequence:CCGGAGGCGACAGCCTGGATTATAACTCGAGTTATAATCCAGGCTGTCGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)