EMAIL THIS PAGE TO A FRIEND

ITGB1

integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)

193 Gene Product Result for
Synonyms: CD29 FNRB GPIIA MDF2 MSK12 VLA-BETA VLAB
Gene ID:
Human(3688) Summary: Integrins are heterodimeric proteins made up of alpha and beta subunits. At least 18 alpha and 8 beta subunits have been described in mammals. Integrin family members are membrane receptors involved in cell adhesion and recognition in a variety of processes including embryogenesis, hemostasis, tissue repair, immune response and metastatic diffusion of tumor cells. This gene encodes a beta subunit. Multiple alternatively spliced transcript variants which encode different protein isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(16412) integrin beta 1 (fibronectin receptor beta)
Rat(24511) integrin, beta 1
sheep(443141) integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)
Domestic Rabbit(100008898) integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)
domestic guinea pig(100719502) integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)
naked mole-rat(101711253) integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)
chicken(374058) integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)
domestic cat(751821) integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)
cow(281876) integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)
dog(477956) integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)
Horse(100055024) integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW22754 Anti-Integrin β1 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB4300655 Anti-Integrin β1 antibody produced in rabbit affinity isolated antibody mouse, rat, human
western blot pricing
SAB4501582 Anti-Integrin β1, C-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4501583 Anti-Integrin β1, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB2900220 Anti-ITGB1 (AB1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
SAB2900236 Anti-ITGB1 (AB2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution dog, pig, horse, monkey, human, sheep, bovine
immunohistochemistry pricing
SAB2107342 Anti-ITGB1 antibody produced in rabbit affinity isolated antibody goat, sheep, guinea pig, horse, rabbit, human, mouse
ELISA, western blot pricing
SAB4503886 Anti-phospho-Integrin β1 (pThr788) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4503923 Anti-phospho-Integrin β1 (pThr789) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4301237 Anti-phospho-Integrin β1 (pThr789) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
I7783 Anti-phospho-Integrin β1 Receptor (pThr788/pThr789) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4504756 Anti-phospho-ITGB1 (pTyr795) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4301381 Anti-phospho-ITGB1 (pTyr795) antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
SAB4700394 Monoclonal Anti-CD29 antibody produced in mouse clone MEM-101A, purified immunoglobulin, buffered aqueous solution canine, pig, human
flow cytometry pricing
SAB4700395 Monoclonal Anti-CD29-APC antibody produced in mouse clone MEM-101A, purified immunoglobulin, buffered aqueous solution human, pig, canine
flow cytometry pricing
SAB4700396 Monoclonal Anti-CD29-Biotin antibody produced in mouse clone MEM-101A, purified immunoglobulin, buffered aqueous solution human, pig, canine
flow cytometry pricing
SAB4700397 Monoclonal Anti-CD29-FITC antibody produced in mouse clone MEM-101A, purified immunoglobulin, buffered aqueous solution canine, human, pig
flow cytometry pricing
SAB4700398 Monoclonal Anti-CD29-PE antibody produced in mouse clone MEM-101A, purified immunoglobulin, buffered aqueous solution canine, pig, human
flow cytometry pricing
I8638 Monoclonal Anti-Integrin β1 antibody produced in mouse clone W1B10, purified immunoglobulin, buffered aqueous solution chicken
immunofluorescence, immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010578 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010578 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010578 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002211 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002211 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002211 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU065071 MISSION® esiRNA esiRNA human ITGB1 (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
ECM445 β1 Integrin Partners Kit pricing
MAB2079-AF647 Anti-Integrin β1, activated, clone HUTS-4, AlexaFluor® 647 Conjugate This Anti-Integrin β1, activated, clone HUTS-4, AlexaFluor® 647 Conjugate is validated for use in Immunocytochemistry for the detection of Integrin β1. pricing
MAB1965 Anti-Integrin β1 Antibody, a.a. 82-87, clone JB1A (a.k.a. J10) This Anti-Integrin β1 Antibody, a.a. 82-87, clone JB1A (a.k.a. J10) is validated for use in FC, IH, IP, FUNC, WB for the detection of Integrin β1. pricing
MAB2079-AF555 Anti-Integrin β1 Antibody, activated, clone HUTS-4, Alexa Fluor® 555 This Anti-Integrin β1 Antibody, activated, clone HUTS-4, Alexa Fluor® 555 is validated for use in Immunocytochemistry for the detection of Integrin β1. pricing
MAB19294 Anti-Integrin β1 Antibody, active β1 integrins, clone TASC/9D11 Detect the Integrin β1 protein using this Anti-Integrin β1, active β1 integrins, clone TASC/9D11 validated for use in IP & ICC. pricing
MAB2247 Anti-Integrin β1 Antibody, clone 12G10 Anti-Integrin β1 Antibody, clone 12G10 detects level of Integrin β1 & has been published & validated for use in ELISA, FC, IP, FUNC, CULT & WB. pricing
MAB2247-I Anti-Integrin β1 Antibody, clone 12G10 This Anti-Integrin β1 Antibody, clone 12G10 is validated for use in Western Blotting, Flow Cytometry, Immunofluorescence for the detection of Integrin β1. pricing
MAB2000 Anti-Integrin β1 Antibody, clone HB1.1 Anti-Integrin β1 Antibody, clone HB1.1 detects level of Integrin β1 & has been published & validated for use in FC, IP, WB, IH. pricing
MAB1997 Anti-Integrin β1 Antibody, clone MB1.2 Anti-Integrin β1 Antibody, clone MB1.2 is an antibody against Integrin β1 for use in FC, IH, IP & WB. pricing
MAB1997-AF647 Anti-Integrin β1 Antibody, clone MB1.2 Antibody, Alexa Fluor® 647 Conjugate Anti-Integrin 1, clone MB1.2, Alexa Fluor® 647 Conjugate, Cat. No. MAB1997-AF647, is a highly specific rat monoclonal antibody that targets Integrin 1 and has been tested in Flow Cytometry and Immunocytochemistry. pricing
MAB1987 Anti-Integrin β1 Antibody, clone P4C10 Detect Integrin β1 using this Anti-Integrin β1 Antibody, clone P4C10 validated for use in ELISA, IP, WB & IC. pricing
MAB1987Z Anti-Integrin β1 Antibody, clone P4C10, azide free Anti-Integrin β1 Antibody, clone P4C10, azide free detects level of Integrin β1 & has been published & validated for use in ELISA, IC, IP, FUNC & WB. pricing
MAB1951 Anti-Integrin β1 Antibody, clone P4G11 Anti-Integrin β1 Antibody, clone P4G11 is an antibody against Integrin β1 for use in ELISA, FC, IC, IH, IH(P), IP, FUNC, CULT. pricing
MAB1951Z Anti-Integrin β1 Antibody, clone P4G11, azide free This Anti-Integrin β1 Antibody, clone P4G11, azide free is validated for use in ELISA, FC, IP, FUNC, FUNC, IC, IH for the detection of Integrin β1. pricing
MAB1951F Anti-Integrin β1 Antibody, clone P4G11, FITC conjugated Detect Integrin β1 using this Anti-Integrin β1 Antibody, clone P4G11, FITC conjugated validated for use in FC, IF, IH. pricing
MAB1959 Anti-Integrin β1 Antibody, clone P5D2 Anti-Integrin β1 Antibody, clone P5D2 detects level of Integrin β1 & has been published & validated for use in ELISA, FC, IC, IH & IP. pricing
MAB1959Z Anti-Integrin β1 Antibody, clone P5D2 (Azide Free)| MAB1959 Anti-Integrin β1 Antibody, clone P5D2 (Azide Free) detects level of Integrin β1 & has been published & validated for use in ELISA, FC, IC, IH, IP, FUNC. pricing
CBL481 Anti-Integrin β1 Antibody, clone TDM29 Anti-Integrin β1 Antibody, clone TDM29 is an antibody against Integrin β1 for use in FC, IF & IP. pricing
CBL481P Anti-Integrin β1 Antibody, clone TDM29, Phycoerythrin conjugated This Anti-Integrin β1 Antibody, clone TDM29, Phycoerythrin conjugated is validated for use in FC for the detection of Integrin β1. pricing
AB1952P Anti-Integrin β1 Antibody, cytosolic Detect Integrin β1 using this Anti-Integrin β1 Antibody, cytosolic validated for use in IP & WB. pricing
CBL481F Anti-Integrin β1 Antibody, FITC conjugated, clone TDM29 Anti-Integrin β1 Antibody, FITC conjugated, clone TDM29 is an antibody against Integrin β1d for use in FC. pricing
AB1929 Anti-Integrin β1 Antibody, phospho-specific [Thr788/Thr789] Anti-Integrin β1 Antibody, phospho-specific [Thr788/Thr789] is an antibody against Integrin β1 for use in WB. pricing
MAB1981 Anti-Integrin β1 Antibody, within a.a. 588-706 of human β1, clone LM534 Anti-Integrin β1 Antibody, within a.a. 588-706 of human β1, clone LM534 detects level of Integrin β1 & has been published & validated for use in FC, IH, IH(P), IP & WB. pricing
MAB1900 Anti-Integrin β1D Antibody, CT cytoplasmic domain, clone 2B1 This Anti-Integrin β1D Antibody, C-terminus cytoplasmic domain, clone 2B1 is validated for use in WB, IC, IH for the detection of Integrin β1D. pricing
MAB1984-I Anti-Integrin α5β1 Antibody, clone BMA5 This Anti-Integrin α5β1 Antibody, clone BMA5 is validated for use in Flow Cytometry, Immunoprecipitation, Affects Function for the detection of Integrin α5β1. pricing
MABT529 Anti-Integrin beta-1 (CD29) Antibody, clone 13C4.1 This mouse monoclonal Anti-Integrin beta-1 (CD29), clone 13C4.1, Cat. No. MABT529, is validated for use in Immunohistochemistry (Paraffin) and Western Blotting for the detection of Integrin beta-1. pricing
AB1952 Anti-Integrin beta1 Antibody, Cytosolic Anti-Integrin beta1 Antibody, Cytosolic detects level of Integrin beta1 & has been published & validated for use in IP & WB. pricing
MABT821 Anti-Integrin beta1 (CD29) Antibody, clone mAb13 Anti-Integrin beta1 (CD29), clone mAb13, Cat. No. MABT821, is a rat monoclonal antibody that detects integrin beta-1 and has been tested for use in Immunocytochemistry, Immunoprecipitation, and Inhibition studies. pricing
MABT409 Anti-Integrin Beta1, clone AIIB2 (Azide Free) Antibody This Anti-Integrin Beta1, clone AIIB2 (Azide Free) Antibody is validated for use in Western Blotting and Immunocytochemistry and Activity Assay and Immunoprecipitation and Immunohistochemistry for the detection of Integrin Beta1. pricing
AB8124 Anti-phospho-Integrin β1 (Ser785) Antibody Detect phospho-Integrin β1 (Ser785) using this Anti-phospho-Integrin β1 (Ser785) Antibody validated for use in WB. pricing
AB8123 Anti-phospho-Integrin β1 (Thr788/789) Antibody This Anti-phospho-Integrin β1 (Thr788/789) Antibody is validated for use in WB for the detection of phospho-Integrin β1 (Thr788/789). pricing
AB8125 Anti-phospho-Integrin β1 (Tyr783) Antibody Anti-phospho-Integrin β1 (Tyr783) Antibody detects level of phospho-Integrin β1 (Tyr783) & has been published & validated for use in WB. pricing
AB8126 Anti-phospho-Integrin β1 (Tyr795) Antibody Anti-phospho-Integrin β1 (Tyr795) Antibody is an antibody against phospho-Integrin β1 (Tyr795) for use in WB. pricing
ECM470 Integrin β1β3 Investigator Kit pricing
ECM531 β Integrin-mediated Cell Adhesion Array Kit, colorimetric This assay can substitute for FACS analysis & is useful for screening human adherent cells for cell surface integrins or for monitoring in vitro cell differentiation or genetic modification of cells. pricing
ECM534 β Integrin-mediated Cell Adhesion Array Kit, fluorimetric The Beta Integrin-Mediated Cell Adhesion Array Kit can be used for assessing the presence or absence of specific integrins on the cell surface. pricing
FCMAB375A4 Milli-Mark™ Anti-Integrin β1-Alexa Fluor® 488 Antibody, clone P5D2 Milli-Mark Anti-Integrin β1-Alexa Fluor 488 Antibody, clone P5D2 detects level of Integrin β1 & has been published & validated for use in FC. pricing
FCMAB269F Milli-Mark™ Anti-Integrin β1 (CD29)-FITC conjugate Antibody, clone MB1.2 This Milli-Mark Anti-Integrin β1 (CD29)-FITC conjugate Antibody, clone MB1.2 is validated for use in FC for the detection of Integrin β1 (CD29) conjugate. pricing
FCMAB342F Milli-Mark™ Anti-Integrin β1-FITC Antibody, clone 6S6 This Milli-Mark Anti-Integrin β1-FITC Antibody, clone 6S6 is validated for use in FC for the detection of Integrin β1. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002211 Rosetta Predictions human pricing
NM_033666 Rosetta Predictions human pricing
NM_033667 Rosetta Predictions human pricing
NM_033668 Rosetta Predictions human pricing
NM_033669 Rosetta Predictions human pricing
NM_133376 Rosetta Predictions human pricing
NM_017022 Rosetta Predictions rat pricing
NM_010578 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002211 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333437 predicted 1985
2 SASI_Hs01_00159474 predicted 667
3 SASI_Hs01_00159475 predicted 1581
4 SASI_Hs01_00159476 predicted 1460
5 SASI_Hs01_00159477 predicted 1310
6 SASI_Hs01_00159478 predicted 939
7 SASI_Hs01_00159479 predicted 1895
8 SASI_Hs01_00159480 predicted 1826
9 SASI_Hs01_00159481 predicted 1321
10 SASI_Hs01_00159482 predicted 1566
11 SASI_Hs01_00159473 predicted 1633
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033666 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361474 predicted 1768
2 SASI_Hs01_00034916 predicted 451
3 SASI_Hs01_00034917 predicted 1358
4 SASI_Hs01_00034918 predicted 1243
5 SASI_Hs01_00034919 predicted 1088
6 SASI_Hs01_00034920 predicted 711
7 SASI_Hs01_00034921 predicted 1670
8 SASI_Hs01_00034922 predicted 1604
9 SASI_Hs01_00034923 predicted 1101
10 SASI_Hs01_00034924 predicted 1338
11 SASI_Hs01_00034915 predicted 1504
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033667 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361475 predicted 1772
2 SASI_Hs01_00219309 predicted 454
3 SASI_Hs01_00219310 predicted 1358
4 SASI_Hs01_00219311 predicted 1239
5 SASI_Hs01_00219312 predicted 1084
6 SASI_Hs01_00219313 predicted 716
7 SASI_Hs01_00219314 predicted 1672
8 SASI_Hs01_00219315 predicted 1604
9 SASI_Hs01_00219316 predicted 1098
10 SASI_Hs01_00219317 predicted 1342
11 SASI_Hs01_00219308 predicted 1508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033668 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361476 predicted 1772
2 SASI_Hs01_00164655 predicted 451
3 SASI_Hs01_00164656 predicted 1358
4 SASI_Hs01_00164657 predicted 1243
5 SASI_Hs01_00164658 predicted 1090
6 SASI_Hs01_00164659 predicted 717
7 SASI_Hs01_00164660 predicted 1672
8 SASI_Hs01_00164661 predicted 1604
9 SASI_Hs01_00164662 predicted 1102
10 SASI_Hs01_00164663 predicted 1339
11 SASI_Hs01_00164654 predicted 1511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033669 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361477 predicted 1763
2 SASI_Hs01_00085987 predicted 452
3 SASI_Hs01_00085988 predicted 1357
4 SASI_Hs01_00085989 predicted 1237
5 SASI_Hs01_00085990 predicted 1084
6 SASI_Hs01_00085991 predicted 712
7 SASI_Hs01_00085992 predicted 1674
8 SASI_Hs01_00085993 predicted 1600
9 SASI_Hs01_00085994 predicted 1098
10 SASI_Hs01_00085995 predicted 1342
11 SASI_Hs01_00085986 predicted 1514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133376 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363086 predicted 1906
2 SASI_Hs01_00198677 predicted 590
3 SASI_Hs01_00198678 predicted 1495
4 SASI_Hs01_00198679 predicted 1381
5 SASI_Hs01_00198680 predicted 1218
6 SASI_Hs01_00198681 predicted 852
7 SASI_Hs01_00198682 predicted 1813
8 SASI_Hs01_00198683 predicted 1739
9 SASI_Hs01_00198684 predicted 1233
10 SASI_Hs01_00198685 predicted 1475
11 SASI_Hs01_00198676 predicted 1644
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017022 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098411 predicted 1424
2 SASI_Rn01_00098412 predicted 1825
3 SASI_Rn02_00261190 predicted 287
4 SASI_Rn02_00261191 predicted 393
5 SASI_Rn02_00261192 predicted 915
6 SASI_Rn01_00098413 predicted 1213
7 SASI_Rn01_00098414 predicted 1291
8 SASI_Rn01_00098415 predicted 1104
9 SASI_Rn01_00098417 predicted 1804
10 SASI_Rn01_00098420 predicted 1119
11 SASI_Rn01_00098416 predicted 1125
12 SASI_Rn01_00098418 predicted 1157
13 SASI_Rn01_00098419 predicted 1296
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010578 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049212 predicted 1696
2 SASI_Mm01_00049214 predicted 2288
3 SASI_Mm01_00049215 predicted 1753
4 SASI_Mm01_00049216 predicted 1335
5 SASI_Mm01_00049217 predicted 1112
6 SASI_Mm01_00049218 predicted 2061
7 SASI_Mm01_00049219 predicted 787
8 SASI_Mm01_00049220 predicted 1128
9 SASI_Mm02_00318859 predicted 1741
10 SASI_Mm02_00318860 predicted 2301
11 SASI_Mm01_00049213 predicted 1229
12 SASI_Mm01_00049221 predicted 2264
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010578
VALIDATED
ITGB1 MISSION shRNA Bacterial Glycerol Stock
integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010578.1-318s21c1
Sequence:CCGGTGGTGTACAAATACGACATTTCTCGAGAAATGTCGTATTTGTACACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010578.1-363s21c1
Sequence:CCGGGCACGATGTGATGATTTAGAACTCGAGTTCTAAATCATCACATCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010578.1-1111s21c1
Sequence:CCGGGCCATTACTATGATTATCCTTCTCGAGAAGGATAATCATAGTAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010578.1-2358s21c1
Sequence:CCGGCCCGACATCATCCCAATTGTACTCGAGTACAATTGGGATGATGTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010578.1-3061s21c1
Sequence:CCGGTGTTGACAGTTTCCAATTAAACTCGAGTTTAATTGGAAACTGTCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348624    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010578.2-2893s21c1
Sequence:CCGGGACTTGAGAAAGGATCTTTATCTCGAGATAAAGATCCTTTCTCAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010578.1-1202s1c1
Sequence:CCGGCCAACCTGTTTACAAGGAATTCTCGAGAATTCCTTGTAAACAGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010578.1-2047s1c1
Sequence:CCGGCCAAGTTTCAAGGGCCAACTTCTCGAGAAGTTGGCCCTTGAAACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010578.1-2358s1c1
Sequence:CCGGCCCGACATCATCCCAATTGTACTCGAGTACAATTGGGATGATGTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010578.1-363s1c1
Sequence:CCGGGCACGATGTGATGATTTAGAACTCGAGTTCTAAATCATCACATCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010578.1-1111s1c1
Sequence:CCGGGCCATTACTATGATTATCCTTCTCGAGAAGGATAATCATAGTAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010578
VALIDATED
ITGB1 MISSION shRNA shRNA Plasmid DNA
integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010578.1-318s21c1
Sequence:CCGGTGGTGTACAAATACGACATTTCTCGAGAAATGTCGTATTTGTACACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010578.1-363s21c1
Sequence:CCGGGCACGATGTGATGATTTAGAACTCGAGTTCTAAATCATCACATCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010578.1-1111s21c1
Sequence:CCGGGCCATTACTATGATTATCCTTCTCGAGAAGGATAATCATAGTAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010578.1-2358s21c1
Sequence:CCGGCCCGACATCATCCCAATTGTACTCGAGTACAATTGGGATGATGTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010578.1-3061s21c1
Sequence:CCGGTGTTGACAGTTTCCAATTAAACTCGAGTTTAATTGGAAACTGTCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348624    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010578.2-2893s21c1
Sequence:CCGGGACTTGAGAAAGGATCTTTATCTCGAGATAAAGATCCTTTCTCAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010578.1-1202s1c1
Sequence:CCGGCCAACCTGTTTACAAGGAATTCTCGAGAATTCCTTGTAAACAGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010578.1-2047s1c1
Sequence:CCGGCCAAGTTTCAAGGGCCAACTTCTCGAGAAGTTGGCCCTTGAAACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010578.1-2358s1c1
Sequence:CCGGCCCGACATCATCCCAATTGTACTCGAGTACAATTGGGATGATGTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010578.1-363s1c1
Sequence:CCGGGCACGATGTGATGATTTAGAACTCGAGTTCTAAATCATCACATCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010578.1-1111s1c1
Sequence:CCGGGCCATTACTATGATTATCCTTCTCGAGAAGGATAATCATAGTAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010578
VALIDATED
ITGB1 MISSION shRNA Lentiviral Transduction Particles
integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010578.1-318s21c1
Sequence:CCGGTGGTGTACAAATACGACATTTCTCGAGAAATGTCGTATTTGTACACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010578.1-363s21c1
Sequence:CCGGGCACGATGTGATGATTTAGAACTCGAGTTCTAAATCATCACATCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010578.1-1111s21c1
Sequence:CCGGGCCATTACTATGATTATCCTTCTCGAGAAGGATAATCATAGTAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010578.1-2358s21c1
Sequence:CCGGCCCGACATCATCCCAATTGTACTCGAGTACAATTGGGATGATGTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010578.1-3061s21c1
Sequence:CCGGTGTTGACAGTTTCCAATTAAACTCGAGTTTAATTGGAAACTGTCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348624    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010578.2-2893s21c1
Sequence:CCGGGACTTGAGAAAGGATCTTTATCTCGAGATAAAGATCCTTTCTCAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010578.1-1202s1c1
Sequence:CCGGCCAACCTGTTTACAAGGAATTCTCGAGAATTCCTTGTAAACAGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010578.1-2047s1c1
Sequence:CCGGCCAAGTTTCAAGGGCCAACTTCTCGAGAAGTTGGCCCTTGAAACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010578.1-2358s1c1
Sequence:CCGGCCCGACATCATCCCAATTGTACTCGAGTACAATTGGGATGATGTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010578.1-363s1c1
Sequence:CCGGGCACGATGTGATGATTTAGAACTCGAGTTCTAAATCATCACATCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010578.1-1111s1c1
Sequence:CCGGGCCATTACTATGATTATCCTTCTCGAGAAGGATAATCATAGTAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002211
VALIDATED
ITGB1 MISSION shRNA Bacterial Glycerol Stock
integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002211.3-1831s21c1
Sequence:CCGGTTTGTAGGAAGAGGGATAATACTCGAGTATTATCCCTCTTCCTACAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002211.3-316s21c1
Sequence:CCGGCCAAATCATGTGGAGAATGTACTCGAGTACATTCTCCACATGATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002211.3-2452s21c1
Sequence:CCGGGCCTTGCATTACTGCTGATATCTCGAGATATCAGCAGTAATGCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002211.3-445s21c1
Sequence:CCGGGCCCTCCAGATGACATAGAAACTCGAGTTTCTATGTCATCTGGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275133    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002211.3-2679s21c1
Sequence:CCGGTAGGTAGCTTTAGGGCAATATCTCGAGATATTGCCCTAAAGCTACCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002211.2-1153s1c1
Sequence:CCGGCCTGTTTACAAGGAGCTGAAACTCGAGTTTCAGCTCCTTGTAAACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002211.2-2357s1c1
Sequence:CCGGGCCTTGCATTACTGCTGATATCTCGAGATATCAGCAGTAATGCAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002211.2-350s1c1
Sequence:CCGGGCCCTCCAGATGACATAGAAACTCGAGTTTCTATGTCATCTGGAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002211.2-1286s1c1
Sequence:CCGGGCAAATTGTCAGAAGGAGTAACTCGAGTTACTCCTTCTGACAATTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_002211.2-221s1c1
Sequence:CCGGCCAAATCATGTGGAGAATGTACTCGAGTACATTCTCCACATGATTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002211
VALIDATED
ITGB1 MISSION shRNA shRNA Plasmid DNA
integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002211.3-1831s21c1
Sequence:CCGGTTTGTAGGAAGAGGGATAATACTCGAGTATTATCCCTCTTCCTACAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002211.3-316s21c1
Sequence:CCGGCCAAATCATGTGGAGAATGTACTCGAGTACATTCTCCACATGATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002211.3-2452s21c1
Sequence:CCGGGCCTTGCATTACTGCTGATATCTCGAGATATCAGCAGTAATGCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002211.3-445s21c1
Sequence:CCGGGCCCTCCAGATGACATAGAAACTCGAGTTTCTATGTCATCTGGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275133    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002211.3-2679s21c1
Sequence:CCGGTAGGTAGCTTTAGGGCAATATCTCGAGATATTGCCCTAAAGCTACCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002211.2-1153s1c1
Sequence:CCGGCCTGTTTACAAGGAGCTGAAACTCGAGTTTCAGCTCCTTGTAAACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002211.2-2357s1c1
Sequence:CCGGGCCTTGCATTACTGCTGATATCTCGAGATATCAGCAGTAATGCAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002211.2-350s1c1
Sequence:CCGGGCCCTCCAGATGACATAGAAACTCGAGTTTCTATGTCATCTGGAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002211.2-1286s1c1
Sequence:CCGGGCAAATTGTCAGAAGGAGTAACTCGAGTTACTCCTTCTGACAATTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_002211.2-221s1c1
Sequence:CCGGCCAAATCATGTGGAGAATGTACTCGAGTACATTCTCCACATGATTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002211
VALIDATED
ITGB1 MISSION shRNA Lentiviral Transduction Particles
integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002211.3-1831s21c1
Sequence:CCGGTTTGTAGGAAGAGGGATAATACTCGAGTATTATCCCTCTTCCTACAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002211.3-316s21c1
Sequence:CCGGCCAAATCATGTGGAGAATGTACTCGAGTACATTCTCCACATGATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002211.3-2452s21c1
Sequence:CCGGGCCTTGCATTACTGCTGATATCTCGAGATATCAGCAGTAATGCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002211.3-445s21c1
Sequence:CCGGGCCCTCCAGATGACATAGAAACTCGAGTTTCTATGTCATCTGGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275133    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002211.3-2679s21c1
Sequence:CCGGTAGGTAGCTTTAGGGCAATATCTCGAGATATTGCCCTAAAGCTACCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002211.2-1153s1c1
Sequence:CCGGCCTGTTTACAAGGAGCTGAAACTCGAGTTTCAGCTCCTTGTAAACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002211.2-2357s1c1
Sequence:CCGGGCCTTGCATTACTGCTGATATCTCGAGATATCAGCAGTAATGCAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002211.2-350s1c1
Sequence:CCGGGCCCTCCAGATGACATAGAAACTCGAGTTTCTATGTCATCTGGAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002211.2-1286s1c1
Sequence:CCGGGCAAATTGTCAGAAGGAGTAACTCGAGTTACTCCTTCTGACAATTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_002211.2-221s1c1
Sequence:CCGGCCAAATCATGTGGAGAATGTACTCGAGTACATTCTCCACATGATTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)