EMAIL THIS PAGE TO A FRIEND

ITGB1BP1

integrin beta 1 binding protein 1

84 Gene Product Result for
Synonyms: ICAP-1A ICAP-1B ICAP-1alpha ICAP1 ICAP1A ICAP1B
UniProtKB ID: O14713, D6W4Y9, O14714, Q53RS0
Gene ID:
Human(9270) Summary: The cytoplasmic domains of integrins are essential for cell adhesion. The protein encoded by this gene binds to the beta1 integrin cytoplasmic domain. The interaction between this protein and beta1 integrin is highly specific. Two isoforms of this protein are derived from alternatively spliced transcripts. The shorter form of this protein does not interact with the beta1 integrin cytoplasmic domain. The longer form is a phosphoprotein and the extent of its phosphorylation is regulated by the cell-matrix interaction, suggesting an important role of this protein during integrin-dependent cell adhesion. [provided by RefSeq, Jul 2008]
Mouse(16413) integrin beta 1 binding protein 1
Rat(298914) integrin beta 1 binding protein 1
Zebrafish(641420) integrin beta 1 binding protein 1
cow(513531) integrin beta 1 binding protein 1
domestic cat(101089763) integrin beta 1 binding protein 1
dog(475660) integrin beta 1 binding protein 1
chicken(421928) integrin beta 1 binding protein 1
domestic guinea pig(100732360) integrin beta 1 binding protein 1
naked mole-rat(101723391) integrin beta 1 binding protein 1
sheep(101116297) integrin beta 1 binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004763 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004763 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004763 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008403 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008403 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008403 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004763 Rosetta Predictions human pricing
NM_022334 Rosetta Predictions human pricing
NM_001106719 Rosetta Predictions rat pricing
NM_008403 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004763 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159972 predicted 943
2 SASI_Hs01_00159973 predicted 948
3 SASI_Hs01_00159975 predicted 238
4 SASI_Hs01_00159976 predicted 223
5 SASI_Hs02_00338255 predicted 943
6 SASI_Hs01_00159979 predicted 209
7 SASI_Hs02_00338256 predicted 1039
8 SASI_Hs02_00338257 predicted 224
9 SASI_Hs02_00338258 predicted 1031
10 SASI_Hs02_00338259 predicted 217
11 SASI_Hs01_00159974 predicted 1027
12 SASI_Hs01_00159977 predicted 933
13 SASI_Hs01_00159978 predicted 1005
14 SASI_Hs01_00159980 predicted 925
15 SASI_Hs01_00159981 predicted 1043
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022334 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044741 predicted 792
2 SASI_Hs01_00044742 predicted 792
3 SASI_Hs01_00044744 predicted 234
4 SASI_Hs01_00044745 predicted 223
5 SASI_Hs02_00355613 predicted 789
6 SASI_Hs01_00044748 predicted 206
7 SASI_Hs02_00355614 predicted 883
8 SASI_Hs02_00355615 predicted 219
9 SASI_Hs02_00355616 predicted 886
10 SASI_Hs02_00355617 predicted 212
11 SASI_Hs01_00044743 predicted 870
12 SASI_Hs01_00044746 predicted 784
13 SASI_Hs01_00044747 predicted 856
14 SASI_Hs01_00044749 predicted 782
15 SASI_Hs01_00044750 predicted 891
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106719 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221718 predicted 821
2 SASI_Rn02_00221719 predicted 609
3 SASI_Rn02_00221720 predicted 842
4 SASI_Rn02_00221721 predicted 393
5 SASI_Rn02_00221722 predicted 529
6 SASI_Rn02_00221723 predicted 841
7 SASI_Rn02_00221724 predicted 797
8 SASI_Rn02_00221725 predicted 518
9 SASI_Rn02_00221726 predicted 632
10 SASI_Rn02_00221727 predicted 304
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008403 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169432 predicted 513
2 SASI_Mm01_00169434 predicted 527
3 SASI_Mm01_00169435 predicted 447
4 SASI_Mm01_00169436 predicted 819
5 SASI_Mm01_00169437 predicted 826
6 SASI_Mm01_00169438 predicted 865
7 SASI_Mm01_00169439 predicted 363
8 SASI_Mm02_00313842 predicted 756
9 SASI_Mm01_00169440 predicted 667
10 SASI_Mm01_00169441 predicted 762
11 SASI_Mm01_00169433 predicted 320
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004763
VALIDATED
ITGB1BP1 MISSION shRNA Bacterial Glycerol Stock
integrin beta 1 binding protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004763.3-423s21c1
Sequence:CCGGTGAAGGGCCATTAGACCTGATCTCGAGATCAGGTCTAATGGCCCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004763.2-204s1c1
Sequence:CCGGGCAGTTCCCAAAGTAGCGAAACTCGAGTTTCGCTACTTTGGGAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004763.2-415s1c1
Sequence:CCGGTGAAGGGCCATTAGACCTGATCTCGAGATCAGGTCTAATGGCCCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_004763.2-457s1c1
Sequence:CCGGGCAAGATGGAAAGTTGCCTTTCTCGAGAAAGGCAACTTTCCATCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004763.2-1272s1c1
Sequence:CCGGCCAACCACAATTCCTAGAGTTCTCGAGAACTCTAGGAATTGTGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004763.2-345s1c1
Sequence:CCGGCCTGTGCAGAATTTCGAATAACTCGAGTTATTCGAAATTCTGCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004763.3-353s21c1
Sequence:CCGGCCTGTGCAGAATTTCGAATAACTCGAGTTATTCGAAATTCTGCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004763.3-465s21c1
Sequence:CCGGGCAAGATGGAAAGTTGCCTTTCTCGAGAAAGGCAACTTTCCATCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004763.3-212s21c1
Sequence:CCGGGCAGTTCCCAAAGTAGCGAAACTCGAGTTTCGCTACTTTGGGAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004763
VALIDATED
ITGB1BP1 MISSION shRNA shRNA Plasmid DNA
integrin beta 1 binding protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004763.3-423s21c1
Sequence:CCGGTGAAGGGCCATTAGACCTGATCTCGAGATCAGGTCTAATGGCCCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004763.2-204s1c1
Sequence:CCGGGCAGTTCCCAAAGTAGCGAAACTCGAGTTTCGCTACTTTGGGAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004763.2-415s1c1
Sequence:CCGGTGAAGGGCCATTAGACCTGATCTCGAGATCAGGTCTAATGGCCCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_004763.2-457s1c1
Sequence:CCGGGCAAGATGGAAAGTTGCCTTTCTCGAGAAAGGCAACTTTCCATCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004763.2-1272s1c1
Sequence:CCGGCCAACCACAATTCCTAGAGTTCTCGAGAACTCTAGGAATTGTGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004763.2-345s1c1
Sequence:CCGGCCTGTGCAGAATTTCGAATAACTCGAGTTATTCGAAATTCTGCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004763.3-353s21c1
Sequence:CCGGCCTGTGCAGAATTTCGAATAACTCGAGTTATTCGAAATTCTGCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004763.3-465s21c1
Sequence:CCGGGCAAGATGGAAAGTTGCCTTTCTCGAGAAAGGCAACTTTCCATCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004763.3-212s21c1
Sequence:CCGGGCAGTTCCCAAAGTAGCGAAACTCGAGTTTCGCTACTTTGGGAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004763
VALIDATED
ITGB1BP1 MISSION shRNA Lentiviral Transduction Particles
integrin beta 1 binding protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004763.3-423s21c1
Sequence:CCGGTGAAGGGCCATTAGACCTGATCTCGAGATCAGGTCTAATGGCCCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004763.2-204s1c1
Sequence:CCGGGCAGTTCCCAAAGTAGCGAAACTCGAGTTTCGCTACTTTGGGAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004763.2-415s1c1
Sequence:CCGGTGAAGGGCCATTAGACCTGATCTCGAGATCAGGTCTAATGGCCCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_004763.2-457s1c1
Sequence:CCGGGCAAGATGGAAAGTTGCCTTTCTCGAGAAAGGCAACTTTCCATCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004763.2-1272s1c1
Sequence:CCGGCCAACCACAATTCCTAGAGTTCTCGAGAACTCTAGGAATTGTGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004763.2-345s1c1
Sequence:CCGGCCTGTGCAGAATTTCGAATAACTCGAGTTATTCGAAATTCTGCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004763.3-353s21c1
Sequence:CCGGCCTGTGCAGAATTTCGAATAACTCGAGTTATTCGAAATTCTGCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004763.3-465s21c1
Sequence:CCGGGCAAGATGGAAAGTTGCCTTTCTCGAGAAAGGCAACTTTCCATCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004763.3-212s21c1
Sequence:CCGGGCAGTTCCCAAAGTAGCGAAACTCGAGTTTCGCTACTTTGGGAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008403
VALIDATED
ITGB1BP1 MISSION shRNA Bacterial Glycerol Stock
integrin beta 1 binding protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008403.4-368s21c1
Sequence:CCGGATGTGCTGAGTTCCGAATAAACTCGAGTTTATTCGGAACTCAGCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008403.4-859s21c1
Sequence:CCGGGGACTATTAGAGGGTGTAATGCTCGAGCATTACACCCTCTAATAGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008403.2-505s1c1
Sequence:CCGGCCTTTGGAAGAGGAGTTCATTCTCGAGAATGAACTCCTCTTCCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008403.2-315s1c1
Sequence:CCGGCCTCGATACAGACTCCACTAACTCGAGTTAGTGGAGTCTGTATCGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181676    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008403.2-1650s1c1
Sequence:CCGGCGCTGCAACTAGACCAAAGTACTCGAGTACTTTGGTCTAGTTGCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197519    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008403.2-1621s1c1
Sequence:CCGGCCGTTTAGGTTATACAGTATACTCGAGTATACTGTATAACCTAAACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008403.4-367s1c1
Sequence:CCGGCATGTGCTGAGTTCCGAATAACTCGAGTTATTCGGAACTCAGCACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008403.4-504s21c1
Sequence:CCGGCCTTTGGAAGAGGAGTTCATTCTCGAGAATGAACTCCTCTTCCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008403.4-314s21c1
Sequence:CCGGCCTCGATACAGACTCCACTAACTCGAGTTAGTGGAGTCTGTATCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008403.4-391s21c1
Sequence:CCGGATGTTGGTGCCATCGAGAAACCTCGAGGTTTCTCGATGGCACCAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008403
VALIDATED
ITGB1BP1 MISSION shRNA shRNA Plasmid DNA
integrin beta 1 binding protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008403.4-368s21c1
Sequence:CCGGATGTGCTGAGTTCCGAATAAACTCGAGTTTATTCGGAACTCAGCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008403.4-859s21c1
Sequence:CCGGGGACTATTAGAGGGTGTAATGCTCGAGCATTACACCCTCTAATAGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008403.2-505s1c1
Sequence:CCGGCCTTTGGAAGAGGAGTTCATTCTCGAGAATGAACTCCTCTTCCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008403.2-315s1c1
Sequence:CCGGCCTCGATACAGACTCCACTAACTCGAGTTAGTGGAGTCTGTATCGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181676    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008403.2-1650s1c1
Sequence:CCGGCGCTGCAACTAGACCAAAGTACTCGAGTACTTTGGTCTAGTTGCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197519    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008403.2-1621s1c1
Sequence:CCGGCCGTTTAGGTTATACAGTATACTCGAGTATACTGTATAACCTAAACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008403.4-367s1c1
Sequence:CCGGCATGTGCTGAGTTCCGAATAACTCGAGTTATTCGGAACTCAGCACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008403.4-504s21c1
Sequence:CCGGCCTTTGGAAGAGGAGTTCATTCTCGAGAATGAACTCCTCTTCCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008403.4-314s21c1
Sequence:CCGGCCTCGATACAGACTCCACTAACTCGAGTTAGTGGAGTCTGTATCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008403.4-391s21c1
Sequence:CCGGATGTTGGTGCCATCGAGAAACCTCGAGGTTTCTCGATGGCACCAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008403
VALIDATED
ITGB1BP1 MISSION shRNA Lentiviral Transduction Particles
integrin beta 1 binding protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008403.4-368s21c1
Sequence:CCGGATGTGCTGAGTTCCGAATAAACTCGAGTTTATTCGGAACTCAGCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008403.4-859s21c1
Sequence:CCGGGGACTATTAGAGGGTGTAATGCTCGAGCATTACACCCTCTAATAGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008403.2-505s1c1
Sequence:CCGGCCTTTGGAAGAGGAGTTCATTCTCGAGAATGAACTCCTCTTCCAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008403.2-315s1c1
Sequence:CCGGCCTCGATACAGACTCCACTAACTCGAGTTAGTGGAGTCTGTATCGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181676    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008403.2-1650s1c1
Sequence:CCGGCGCTGCAACTAGACCAAAGTACTCGAGTACTTTGGTCTAGTTGCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197519    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008403.2-1621s1c1
Sequence:CCGGCCGTTTAGGTTATACAGTATACTCGAGTATACTGTATAACCTAAACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008403.4-367s1c1
Sequence:CCGGCATGTGCTGAGTTCCGAATAACTCGAGTTATTCGGAACTCAGCACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008403.4-504s21c1
Sequence:CCGGCCTTTGGAAGAGGAGTTCATTCTCGAGAATGAACTCCTCTTCCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008403.4-314s21c1
Sequence:CCGGCCTCGATACAGACTCCACTAACTCGAGTTAGTGGAGTCTGTATCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008403.4-391s21c1
Sequence:CCGGATGTTGGTGCCATCGAGAAACCTCGAGGTTTCTCGATGGCACCAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)