EMAIL THIS PAGE TO A FRIEND

ITGB1BP2

integrin beta 1 binding protein (melusin) 2

50 Gene Product Result for
Synonyms: CHORDC3 ITGB1BP MELUSIN
UniProtKB ID: Q9UKP3, Q549J7
Gene ID:
Mouse(26549) integrin beta 1 binding protein 2
Rat(317258) integrin beta 1 binding protein 2
sheep(101106491) integrin beta 1 binding protein (melusin) 2
Domestic Rabbit(100353208) integrin beta 1 binding protein (melusin) 2
domestic guinea pig(100729365) integrin beta 1 binding protein (melusin) 2
naked mole-rat(101720317) integrin beta 1 binding protein (melusin) 2
chicken(422208) integrin beta 1 binding protein (melusin) 2
cow(539945) integrin beta 1 binding protein (melusin) 2
Horse(100147397) integrin beta 1 binding protein (melusin) 2
dog(480954) integrin beta 1 binding protein (melusin) 2
domestic cat(101093083) integrin beta 1 binding protein (melusin) 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV42358 Anti-ITGB1BP2 antibody produced in rabbit IgG fraction of antiserum pig, bovine, canine, mouse, rat, horse, rabbit, human, guinea pig
immunohistochemistry, western blot pricing
SAB1403190 Monoclonal Anti-ITGB1BP2 antibody produced in mouse clone 3G9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012278 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012278 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012278 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013712 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013712 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013712 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150451 MISSION® esiRNA esiRNA human ITGB1BP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012278 Rosetta Predictions human pricing
NM_001108245 Rosetta Predictions rat pricing
NM_013712 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012278 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078640 predicted 715
2 SASI_Hs02_00344010 predicted 890
3 SASI_Hs01_00078641 predicted 702
4 SASI_Hs01_00078642 predicted 734
5 SASI_Hs01_00078643 predicted 504
6 SASI_Hs01_00078644 predicted 357
7 SASI_Hs01_00078645 predicted 315
8 SASI_Hs01_00078646 predicted 674
9 SASI_Hs01_00078647 predicted 874
10 SASI_Hs01_00078648 predicted 988
11 SASI_Hs01_00078649 predicted 681
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108245 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236754 predicted 818
2 SASI_Rn02_00236755 predicted 229
3 SASI_Rn02_00236756 predicted 409
4 SASI_Rn02_00236757 predicted 735
5 SASI_Rn02_00236758 predicted 365
6 SASI_Rn02_00236759 predicted 443
7 SASI_Rn02_00236760 predicted 939
8 SASI_Rn02_00236761 predicted 723
9 SASI_Rn02_00236762 predicted 676
10 SASI_Rn02_00236763 predicted 216
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013712 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199677 predicted 325
2 SASI_Mm01_00199678 predicted 823
3 SASI_Mm01_00199679 predicted 390
4 SASI_Mm01_00199680 predicted 667
5 SASI_Mm01_00199682 predicted 925
6 SASI_Mm01_00199683 predicted 526
7 SASI_Mm01_00199684 predicted 741
8 SASI_Mm02_00322623 predicted 200
9 SASI_Mm01_00199685 predicted 719
10 SASI_Mm01_00199686 predicted 359
11 SASI_Mm01_00199681 predicted 1083
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012278
ITGB1BP2 MISSION shRNA Bacterial Glycerol Stock
integrin beta 1 binding protein (melusin) 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012278.1-359s21c1
Sequence:CCGGTCTGAAGCTGCTGCCGCTAAACTCGAGTTTAGCGGCAGCAGCTTCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012278.1-736s21c1
Sequence:CCGGAGATTCCACTTCCTGCGTTTACTCGAGTAAACGCAGGAAGTGGAATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012278.1-878s21c1
Sequence:CCGGGATGCCATCTCGGGTTGAAATCTCGAGATTTCAACCCGAGATGGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012278.1-158s1c1
Sequence:CCGGCCGAAAGCGAACTGTAGATTTCTCGAGAAATCTACAGTTCGCTTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146384    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012278.1-1079s1c1
Sequence:CCGGCCAGACAGTTGATGTCTAGATCTCGAGATCTAGACATCAACTGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012278.1-999s1c1
Sequence:CCGGGAAGAATCTGACGATTCAGATCTCGAGATCTGAATCGTCAGATTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012278.1-157s1c1
Sequence:CCGGGCCGAAAGCGAACTGTAGATTCTCGAGAATCTACAGTTCGCTTTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012278.1-271s1c1
Sequence:CCGGGCAGTTCACTTCAGGAGCAAACTCGAGTTTGCTCCTGAAGTGAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012278
ITGB1BP2 MISSION shRNA shRNA Plasmid DNA
integrin beta 1 binding protein (melusin) 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012278.1-359s21c1
Sequence:CCGGTCTGAAGCTGCTGCCGCTAAACTCGAGTTTAGCGGCAGCAGCTTCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012278.1-736s21c1
Sequence:CCGGAGATTCCACTTCCTGCGTTTACTCGAGTAAACGCAGGAAGTGGAATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012278.1-878s21c1
Sequence:CCGGGATGCCATCTCGGGTTGAAATCTCGAGATTTCAACCCGAGATGGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012278.1-158s1c1
Sequence:CCGGCCGAAAGCGAACTGTAGATTTCTCGAGAAATCTACAGTTCGCTTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146384    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012278.1-1079s1c1
Sequence:CCGGCCAGACAGTTGATGTCTAGATCTCGAGATCTAGACATCAACTGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012278.1-999s1c1
Sequence:CCGGGAAGAATCTGACGATTCAGATCTCGAGATCTGAATCGTCAGATTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012278.1-157s1c1
Sequence:CCGGGCCGAAAGCGAACTGTAGATTCTCGAGAATCTACAGTTCGCTTTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012278.1-271s1c1
Sequence:CCGGGCAGTTCACTTCAGGAGCAAACTCGAGTTTGCTCCTGAAGTGAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012278
ITGB1BP2 MISSION shRNA Lentiviral Transduction Particles
integrin beta 1 binding protein (melusin) 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012278.1-359s21c1
Sequence:CCGGTCTGAAGCTGCTGCCGCTAAACTCGAGTTTAGCGGCAGCAGCTTCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012278.1-736s21c1
Sequence:CCGGAGATTCCACTTCCTGCGTTTACTCGAGTAAACGCAGGAAGTGGAATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012278.1-878s21c1
Sequence:CCGGGATGCCATCTCGGGTTGAAATCTCGAGATTTCAACCCGAGATGGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012278.1-158s1c1
Sequence:CCGGCCGAAAGCGAACTGTAGATTTCTCGAGAAATCTACAGTTCGCTTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146384    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012278.1-1079s1c1
Sequence:CCGGCCAGACAGTTGATGTCTAGATCTCGAGATCTAGACATCAACTGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012278.1-999s1c1
Sequence:CCGGGAAGAATCTGACGATTCAGATCTCGAGATCTGAATCGTCAGATTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012278.1-157s1c1
Sequence:CCGGGCCGAAAGCGAACTGTAGATTCTCGAGAATCTACAGTTCGCTTTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012278.1-271s1c1
Sequence:CCGGGCAGTTCACTTCAGGAGCAAACTCGAGTTTGCTCCTGAAGTGAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013712
ITGB1BP2 MISSION shRNA Bacterial Glycerol Stock
integrin beta 1 binding protein (melusin) 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013712.2-397s21c1
Sequence:CCGGCAAACTGCTACCACTTCTTATCTCGAGATAAGAAGTGGTAGCAGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013712.2-397s1c1
Sequence:CCGGCAAACTGCTACCACTTCTTATCTCGAGATAAGAAGTGGTAGCAGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013712.2-1118s21c1
Sequence:CCGGTAACAGCAGACAGTTGAGTTTCTCGAGAAACTCAACTGTCTGCTGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013712.2-750s21c1
Sequence:CCGGTAGTAGTGCTGACGGTCTATGCTCGAGCATAGACCGTCAGCACTACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013712.2-468s21c1
Sequence:CCGGCGGGAGCAGGACTTGACAATACTCGAGTATTGTCAAGTCCTGCTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013712.2-355s21c1
Sequence:CCGGAGAGACCTTGTTCCGAGAAAGCTCGAGCTTTCTCGGAACAAGGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013712.1-464s1c1
Sequence:CCGGCCCAGGATGTGATGCTGTTTACTCGAGTAAACAGCATCACATCCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013712.1-926s1c1
Sequence:CCGGCCCTGATTCACTAGCTGAGAACTCGAGTTCTCAGCTAGTGAATCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184391    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013712.1-1242s1c1
Sequence:CCGGCGTCTCATCTCTCCTCATCATCTCGAGATGATGAGGAGAGATGAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013712
ITGB1BP2 MISSION shRNA shRNA Plasmid DNA
integrin beta 1 binding protein (melusin) 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013712.2-397s21c1
Sequence:CCGGCAAACTGCTACCACTTCTTATCTCGAGATAAGAAGTGGTAGCAGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013712.2-397s1c1
Sequence:CCGGCAAACTGCTACCACTTCTTATCTCGAGATAAGAAGTGGTAGCAGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013712.2-1118s21c1
Sequence:CCGGTAACAGCAGACAGTTGAGTTTCTCGAGAAACTCAACTGTCTGCTGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013712.2-750s21c1
Sequence:CCGGTAGTAGTGCTGACGGTCTATGCTCGAGCATAGACCGTCAGCACTACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013712.2-468s21c1
Sequence:CCGGCGGGAGCAGGACTTGACAATACTCGAGTATTGTCAAGTCCTGCTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013712.2-355s21c1
Sequence:CCGGAGAGACCTTGTTCCGAGAAAGCTCGAGCTTTCTCGGAACAAGGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013712.1-464s1c1
Sequence:CCGGCCCAGGATGTGATGCTGTTTACTCGAGTAAACAGCATCACATCCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013712.1-926s1c1
Sequence:CCGGCCCTGATTCACTAGCTGAGAACTCGAGTTCTCAGCTAGTGAATCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184391    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013712.1-1242s1c1
Sequence:CCGGCGTCTCATCTCTCCTCATCATCTCGAGATGATGAGGAGAGATGAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013712
ITGB1BP2 MISSION shRNA Lentiviral Transduction Particles
integrin beta 1 binding protein (melusin) 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013712.2-397s21c1
Sequence:CCGGCAAACTGCTACCACTTCTTATCTCGAGATAAGAAGTGGTAGCAGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013712.2-397s1c1
Sequence:CCGGCAAACTGCTACCACTTCTTATCTCGAGATAAGAAGTGGTAGCAGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013712.2-1118s21c1
Sequence:CCGGTAACAGCAGACAGTTGAGTTTCTCGAGAAACTCAACTGTCTGCTGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013712.2-750s21c1
Sequence:CCGGTAGTAGTGCTGACGGTCTATGCTCGAGCATAGACCGTCAGCACTACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013712.2-468s21c1
Sequence:CCGGCGGGAGCAGGACTTGACAATACTCGAGTATTGTCAAGTCCTGCTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013712.2-355s21c1
Sequence:CCGGAGAGACCTTGTTCCGAGAAAGCTCGAGCTTTCTCGGAACAAGGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013712.1-464s1c1
Sequence:CCGGCCCAGGATGTGATGCTGTTTACTCGAGTAAACAGCATCACATCCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013712.1-926s1c1
Sequence:CCGGCCCTGATTCACTAGCTGAGAACTCGAGTTCTCAGCTAGTGAATCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184391    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013712.1-1242s1c1
Sequence:CCGGCGTCTCATCTCTCCTCATCATCTCGAGATGATGAGGAGAGATGAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)