EMAIL THIS PAGE TO A FRIEND

ITGB2

integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)

107 Gene Product Result for
Synonyms: CD18 LAD LCAMB LFA-1 MAC-1 MF17 MFI7
UniProtKB ID: P05107, B3KTS8, D3DSM1, Q16418, Q53HS5, Q9UD72
Gene ID:
Human(3689) Summary: The product of this gene belongs to the integrin beta chain family of proteins. Integrins are integral cell-surface proteins composed of an alpha chain and a beta chain. This gene encodes the integrin beta chain beta 2. A given chain may combine with multiple partners resulting in different integrins. For example, beta 2 combines with the alpha L chain to form the integrin LFA-1, and combines with the alpha M chain to form the integrin Mac-1. Integrins are known to participate in cell adhesion as well as cell-surface mediated signalling. Defects in this gene are the cause of leukocyte adhesion deficiency type I (LAD1). Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(16414) integrin beta 2
Rat(309684) integrin, beta 2
Zebrafish(557797) integrin, beta 2
chicken(396181) integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)
domestic cat(101087258) integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)
cow(281877) integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)
Horse(100056128) integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)
dog(403770) integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)
domestic guinea pig(100727919) integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)
naked mole-rat(101703921) integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)
sheep(494433) integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501584 Anti-CD18, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence pricing
GW21356 Anti-ITGB2 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
HPA008877 Anti-ITGB2 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA016894 Anti-ITGB2 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4700400 Monoclonal Anti-CD18 antibody produced in mouse clone MEM-148, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700404 Monoclonal Anti-CD18 antibody produced in mouse clone MEM-48, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700620 Monoclonal Anti-CD18 antibody produced in mouse clone IVA35, purified immunoglobulin, buffered aqueous solution bovine
flow cytometry pricing
SAB4700584 Monoclonal Anti-CD18 antibody produced in rat clone M18/2, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing
SAB4700399 Monoclonal Anti-CD18, low endotoxin antibody produced in mouse clone MEM-148, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700403 Monoclonal Anti-CD18, low endotoxin antibody produced in mouse clone MEM-48, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700585 Monoclonal Anti-CD18, low endotoxin antibody produced in rat clone M18/2, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing
SAB4700401 Monoclonal Anti-CD18-APC antibody produced in mouse clone MEM-148, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700405 Monoclonal Anti-CD18-APC antibody produced in mouse clone MEM-48, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700406 Monoclonal Anti-CD18-Biotin antibody produced in mouse clone MEM-48, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700407 Monoclonal Anti-CD18-FITC antibody produced in mouse clone MEM-48, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700586 Monoclonal Anti-CD18-FITC antibody produced in rat clone M18/2, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing
SAB4700402 Monoclonal Anti-CD18-PE antibody produced in mouse clone MEM-148, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700408 Monoclonal Anti-CD18-PE antibody produced in mouse clone MEM-48, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
WH0003689M1 Monoclonal Anti-ITGB2 antibody produced in mouse clone 5F12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403996 Monoclonal Anti-ITGB2 antibody produced in mouse clone 3C7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0913 AQUA Peptide LTDNSNQFQTEVG[K] mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008404 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008404 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008404 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000211 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000211 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000211 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000211 Rosetta Predictions human pricing
NM_001127491 Rosetta Predictions human pricing
NM_001037780 Rosetta Predictions rat pricing
XM_001069791 Rosetta Predictions rat pricing
XM_001071845 Rosetta Predictions rat pricing
NM_008404 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000211 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245442 predicted 1282
2 SASI_Hs01_00245443 predicted 2452
3 SASI_Hs01_00245444 predicted 2614
4 SASI_Hs01_00245445 predicted 478
5 SASI_Hs01_00245446 predicted 1111
6 SASI_Hs01_00245447 predicted 2630
7 SASI_Hs01_00245448 predicted 1530
8 SASI_Hs01_00245449 predicted 2537
9 SASI_Hs01_00245450 predicted 1016
10 SASI_Hs01_00245451 predicted 1012
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127491 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329664 predicted 1229
2 SASI_Hs02_00329665 predicted 2406
3 SASI_Hs02_00329666 predicted 2566
4 SASI_Hs02_00329667 predicted 437
5 SASI_Hs02_00329668 predicted 1066
6 SASI_Hs02_00329669 predicted 2587
7 SASI_Hs02_00329670 predicted 1483
8 SASI_Hs02_00329671 predicted 2486
9 SASI_Hs02_00329672 predicted 972
10 SASI_Hs02_00329673 predicted 971
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037780 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204574 predicted 1855
2 SASI_Rn02_00204575 predicted 1823
3 SASI_Rn02_00204576 predicted 2540
4 SASI_Rn02_00204577 predicted 2506
5 SASI_Rn02_00204578 predicted 992
6 SASI_Rn02_00204579 predicted 1885
7 SASI_Rn02_00204580 predicted 1631
8 SASI_Rn02_00204581 predicted 1750
9 SASI_Rn02_00204582 predicted 2160
10 SASI_Rn02_00204583 predicted 1843
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069791 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00329313 predicted 2184
2 SASI_Rn02_00329314 predicted 2039
3 SASI_Rn02_00329315 predicted 1886
4 SASI_Rn02_00329316 predicted 2159
5 SASI_Rn02_00329317 predicted 2040
6 SASI_Rn02_00329318 predicted 1871
7 SASI_Rn02_00329319 predicted 2198
8 SASI_Rn02_00329320 predicted 1974
9 SASI_Rn02_00329321 predicted 1956
10 SASI_Rn02_00329322 predicted 1918
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071845 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00336666 predicted 1851
2 SASI_Rn02_00336667 predicted 1820
3 SASI_Rn02_00336668 predicted 2538
4 SASI_Rn02_00336669 predicted 2498
5 SASI_Rn02_00336670 predicted 989
6 SASI_Rn02_00336671 predicted 1888
7 SASI_Rn02_00336672 predicted 1633
8 SASI_Rn02_00336673 predicted 1740
9 SASI_Rn02_00336674 predicted 2160
10 SASI_Rn02_00336675 predicted 1838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008404 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313843 predicted 2367
2 SASI_Mm01_00047645 predicted 1499
3 SASI_Mm02_00313844 predicted 2426
4 SASI_Mm01_00047646 predicted 1896
5 SASI_Mm01_00047647 predicted 391
6 SASI_Mm01_00047648 predicted 848
7 SASI_Mm01_00047649 predicted 1170
8 SASI_Mm02_00313845 predicted 2128
9 SASI_Mm01_00047650 predicted 1069
10 SASI_Mm01_00047652 predicted 981
11 SASI_Mm01_00047644 predicted 1553
12 SASI_Mm01_00047651 predicted 1134
13 SASI_Mm01_00047653 predicted 665
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008404
ITGB2 MISSION shRNA Bacterial Glycerol Stock
integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008404.1-1079s1c1
Sequence:CCGGCCTACTATAAACTCTCCTCTACTCGAGTAGAGGAGAGTTTATAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008404.1-2046s1c1
Sequence:CCGGCGGAAGGAACATTTACAACATCTCGAGATGTTGTAAATGTTCCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008404.1-69s1c1
Sequence:CCGGCCAGGAATGCACCAAGTACAACTCGAGTTGTACTTGGTGCATTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008404.1-2012s1c1
Sequence:CCGGGCTGTTGGATAACTTACACTTCTCGAGAAGTGTAAGTTATCCAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008404.1-1160s1c1
Sequence:CCGGGCAGTAATGGAGCATCGAGTACTCGAGTACTCGATGCTCCATTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008404
ITGB2 MISSION shRNA shRNA Plasmid DNA
integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008404.1-1079s1c1
Sequence:CCGGCCTACTATAAACTCTCCTCTACTCGAGTAGAGGAGAGTTTATAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008404.1-2046s1c1
Sequence:CCGGCGGAAGGAACATTTACAACATCTCGAGATGTTGTAAATGTTCCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008404.1-69s1c1
Sequence:CCGGCCAGGAATGCACCAAGTACAACTCGAGTTGTACTTGGTGCATTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008404.1-2012s1c1
Sequence:CCGGGCTGTTGGATAACTTACACTTCTCGAGAAGTGTAAGTTATCCAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008404.1-1160s1c1
Sequence:CCGGGCAGTAATGGAGCATCGAGTACTCGAGTACTCGATGCTCCATTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008404
ITGB2 MISSION shRNA Lentiviral Transduction Particles
integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008404.1-1079s1c1
Sequence:CCGGCCTACTATAAACTCTCCTCTACTCGAGTAGAGGAGAGTTTATAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008404.1-2046s1c1
Sequence:CCGGCGGAAGGAACATTTACAACATCTCGAGATGTTGTAAATGTTCCTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008404.1-69s1c1
Sequence:CCGGCCAGGAATGCACCAAGTACAACTCGAGTTGTACTTGGTGCATTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008404.1-2012s1c1
Sequence:CCGGGCTGTTGGATAACTTACACTTCTCGAGAAGTGTAAGTTATCCAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008404.1-1160s1c1
Sequence:CCGGGCAGTAATGGAGCATCGAGTACTCGAGTACTCGATGCTCCATTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000211
VALIDATED
ITGB2 MISSION shRNA Bacterial Glycerol Stock
integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000211.1-1131s1c1
Sequence:CCGGCCATCTCATTAAGAATGCTTACTCGAGTAAGCATTCTTAATGAGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000211.1-618s1c1
Sequence:CCGGGCACCCTGATAAGCTGCGAAACTCGAGTTTCGCAGCTTATCAGGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000211.1-1650s1c1
Sequence:CCGGCAAGCTGATATACGGGCAGTACTCGAGTACTGCCCGTATATCAGCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_000211.1-328s1c1
Sequence:CCGGGAAACCCAGGAAGACCACAATCTCGAGATTGTGGTCTTCCTGGGTTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000211.1-959s1c1
Sequence:CCGGGCAACGAATTCGACTACCCATCTCGAGATGGGTAGTCGAATTCGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000211.3-1432s21c1
Sequence:CCGGGTGATGGCGTGCAGATCAATGCTCGAGCATTGATCTGCACGCCATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000211.3-2624s21c1
Sequence:CCGGTTGAGGATGTCACCAATTAACCTCGAGGTTAATTGGTGACATCCTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000211.3-1282s21c1
Sequence:CCGGGCAATGTGGTCCAACTCATTACTCGAGTAATGAGTTGGACCACATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000211.3-892s21c1
Sequence:CCGGAGGTCGGGAAGCAGCTGATTTCTCGAGAAATCAGCTGCTTCCCGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000211.3-2278s21c1
Sequence:CCGGTGGACCGCTACCTCATCTATGCTCGAGCATAGATGAGGTAGCGGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000211
VALIDATED
ITGB2 MISSION shRNA shRNA Plasmid DNA
integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000211.1-1131s1c1
Sequence:CCGGCCATCTCATTAAGAATGCTTACTCGAGTAAGCATTCTTAATGAGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000211.1-618s1c1
Sequence:CCGGGCACCCTGATAAGCTGCGAAACTCGAGTTTCGCAGCTTATCAGGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000211.1-1650s1c1
Sequence:CCGGCAAGCTGATATACGGGCAGTACTCGAGTACTGCCCGTATATCAGCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_000211.1-328s1c1
Sequence:CCGGGAAACCCAGGAAGACCACAATCTCGAGATTGTGGTCTTCCTGGGTTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000211.1-959s1c1
Sequence:CCGGGCAACGAATTCGACTACCCATCTCGAGATGGGTAGTCGAATTCGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000211.3-1432s21c1
Sequence:CCGGGTGATGGCGTGCAGATCAATGCTCGAGCATTGATCTGCACGCCATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000211.3-2624s21c1
Sequence:CCGGTTGAGGATGTCACCAATTAACCTCGAGGTTAATTGGTGACATCCTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000211.3-1282s21c1
Sequence:CCGGGCAATGTGGTCCAACTCATTACTCGAGTAATGAGTTGGACCACATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000211.3-892s21c1
Sequence:CCGGAGGTCGGGAAGCAGCTGATTTCTCGAGAAATCAGCTGCTTCCCGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000211.3-2278s21c1
Sequence:CCGGTGGACCGCTACCTCATCTATGCTCGAGCATAGATGAGGTAGCGGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000211
VALIDATED
ITGB2 MISSION shRNA Lentiviral Transduction Particles
integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000211.1-1131s1c1
Sequence:CCGGCCATCTCATTAAGAATGCTTACTCGAGTAAGCATTCTTAATGAGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000211.1-618s1c1
Sequence:CCGGGCACCCTGATAAGCTGCGAAACTCGAGTTTCGCAGCTTATCAGGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000211.1-1650s1c1
Sequence:CCGGCAAGCTGATATACGGGCAGTACTCGAGTACTGCCCGTATATCAGCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_000211.1-328s1c1
Sequence:CCGGGAAACCCAGGAAGACCACAATCTCGAGATTGTGGTCTTCCTGGGTTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000211.1-959s1c1
Sequence:CCGGGCAACGAATTCGACTACCCATCTCGAGATGGGTAGTCGAATTCGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000211.3-1432s21c1
Sequence:CCGGGTGATGGCGTGCAGATCAATGCTCGAGCATTGATCTGCACGCCATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000211.3-2624s21c1
Sequence:CCGGTTGAGGATGTCACCAATTAACCTCGAGGTTAATTGGTGACATCCTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000211.3-1282s21c1
Sequence:CCGGGCAATGTGGTCCAACTCATTACTCGAGTAATGAGTTGGACCACATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000211.3-892s21c1
Sequence:CCGGAGGTCGGGAAGCAGCTGATTTCTCGAGAAATCAGCTGCTTCCCGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000211.3-2278s21c1
Sequence:CCGGTGGACCGCTACCTCATCTATGCTCGAGCATAGATGAGGTAGCGGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)