EMAIL THIS PAGE TO A FRIEND

ITGB3

integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)

259 Gene Product Result for
Synonyms: BDPLT16 BDPLT2 CD61 GP3A GPIIIa GT
Gene ID:
Human(3690) Summary: The ITGB3 protein product is the integrin beta chain beta 3. Integrins are integral cell-surface proteins composed of an alpha chain and a beta chain. A given chain may combine with multiple partners resulting in different integrins. Integrin beta 3 is found along with the alpha IIb chain in platelets. Integrins are known to participate in cell adhesion as well as cell-surface mediated signalling. [provided by RefSeq, Jul 2008]
Mouse(16416) integrin beta 3
Rat(29302) integrin, beta 3
sheep(100423047) integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)
domestic guinea pig(100731365) integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)
naked mole-rat(101715910) integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)
chicken(374209) integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)
domestic cat(101092159) integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)
cow(282642) integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)
Horse(100009709) integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)
dog(403788) integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501586 Anti-Integrin β3 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4501587 Anti-Integrin β3 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4300361 Anti-ITGB3 (Ab-773) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry, western blot pricing
SAB4300526 Anti-ITGB3 (Ab-785) antibody produced in rabbit affinity isolated antibody mouse, human
western blot pricing
GW21357 Anti-ITGB3 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
HPA027852 Anti-ITGB3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
I7408 Anti-phospho-Integrin β3 (pTyr773) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, rat
western blot pricing
SAB4504440 Anti-phospho-Integrin β3 (pTyr773) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504441 Anti-phospho-Integrin β3 (pTyr785) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4300048 Anti-phospho-ITGB3 (pTyr773) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB4300224 Anti-phospho-ITGB3 (pTyr785) antibody produced in rabbit affinity isolated antibody rat, mouse, human
western blot pricing
SAB4700641 Monoclonal Anti-ITGA2B antibody produced in mouse clone IVA30, purified immunoglobulin, buffered aqueous solution bovine
flow cytometry pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
G4391 Gly-Arg-Gly-Asp-Ser ≥97% (HPLC) human pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
A5376 Acetylsalicylic acid ≥99.0% human pricing
A9041 Arg-Gly-Asp-Ser ≥95% (HPLC) human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016780 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016780 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016780 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000212 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000212 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000212 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
MAB1957 Anti-Integrin β3 Antibody, clone 25E11 This Anti-Integrin β3 Antibody, clone 25E11 is validated for use in FC, IP, IC, FUNC for the detection of Integrin β3. pricing
MAB1957Z Anti-Integrin β3 Antibody, clone 25E11, azide free Detect Integrin β3 using this Anti-Integrin β3 Antibody, clone 25E11, azide free validated for use in FC, IP & IC. pricing
MAB2023Z Anti-Integrin β3 Antibody, clone B3A, azide free Anti-Integrin β3 Antibody, clone B3A, azide free detects level of Integrin β3 & has been published & validated for use in FC, FUNC & WB. pricing
MAB1974 Anti-Integrin β3 Antibody, clone BB10 Anti-Integrin β3 Antibody, clone BB10 is an antibody against Integrin β3 for use in WB, IC, IH. pricing
CBL479 Anti-Integrin β3 Antibody, clone PM6/13 This Anti-Integrin β3 Antibody, clone PM6/13 is validated for use in FC, IP, WB, IH, IH(P) for the detection of Integrin β3. pricing
MAB2008 Anti-Integrin β3 Antibody, clone SAP Detect Integrin β3 using this Anti-Integrin β3 Antibody, clone SAP validated for use in WB, IH, IH(P). pricing
AB1968 Anti-Integrin β3 Antibody, cytoplasmic domain Anti-Integrin β3 Antibody, cytoplasmic domain detects level of Integrin β3 & has been published & validated for use in IP. pricing
CBL479F Anti-Integrin β3 Antibody, FITC conjugated, clone PM 6/13 This Anti-Integrin β3 Antibody, FITC conjugated, clone PM 6/13 is validated for use in FC, IH(P) for the detection of Integrin β3d. pricing
05-769 Anti-Integrin β3 (CD61) Antibody, clone SAP Anti-Integrin β3 (CD61) Antibody, clone SAP detects level of Integrin β3 (CD61) & has been published & validated for use in WB, IC, IH. pricing
AB2984 Anti-Integrin beta-3 Antibody Anti-Integrin beta-3 Antibody is an antibody against Integrin beta-3 for use in WB, IP, IH(P). pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000212 Rosetta Predictions human pricing
NM_153720 Rosetta Predictions rat pricing
NM_016780 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000212 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174219 predicted 1104
2 SASI_Hs01_00174221 predicted 1416
3 SASI_Hs01_00174222 predicted 1933
4 SASI_Hs02_00302099 predicted 2092
5 SASI_Hs01_00174223 predicted 380
6 SASI_Hs01_00174224 predicted 1182
7 SASI_Hs02_00302100 predicted 2114
8 SASI_Hs01_00174225 predicted 2104
9 SASI_Hs01_00174226 predicted 1111
10 SASI_Hs01_00174227 predicted 2166
11 SASI_Hs01_00174220 predicted 2060
12 SASI_Hs01_00174228 predicted 2016
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153720 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084728 predicted 744
2 SASI_Rn01_00084731 predicted 1087
3 SASI_Rn02_00269007 predicted 1081
4 SASI_Rn02_00269008 predicted 638
5 SASI_Rn01_00084732 predicted 817
6 SASI_Rn01_00084733 predicted 920
7 SASI_Rn01_00084734 predicted 1033
8 SASI_Rn01_00084735 predicted 982
9 SASI_Rn01_00084736 predicted 886
10 SASI_Rn02_00269009 predicted 2071
11 SASI_Rn01_00084729 predicted 1120
12 SASI_Rn01_00084730 predicted 658
13 SASI_Rn01_00084737 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016780 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031703 predicted 638
2 SASI_Mm02_00323554 predicted 959
3 SASI_Mm01_00031705 predicted 1293
4 SASI_Mm01_00031706 predicted 1402
5 SASI_Mm01_00031708 predicted 300
6 SASI_Mm01_00031711 predicted 2086
7 SASI_Mm02_00323555 predicted 1171
8 SASI_Mm01_00031712 predicted 1105
9 SASI_Mm01_00031707 predicted 954
10 SASI_Mm02_00323556 predicted 2274
11 SASI_Mm01_00031704 predicted 869
12 SASI_Mm01_00031709 predicted 2176
13 SASI_Mm01_00031710 predicted 402
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016780
VALIDATED
ITGB3 MISSION shRNA Bacterial Glycerol Stock
integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009616    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016780.1-2440s1c1
Sequence:CCGGCATTATGTTTACAGAGGACAACTCGAGTTGTCCTCTGTAAACATAATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016780.1-2244s1c1
Sequence:CCGGGCTCATCTGGAAGCTACTCATCTCGAGATGAGTAGCTTCCAGATGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016780.1-832s1c1
Sequence:CCGGGCATCCCATTTGCTAGTGTTTCTCGAGAAACACTAGCAAATGGGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016780.1-2061s1c1
Sequence:CCGGCGCCGTGAATTGTACCTACAACTCGAGTTGTAGGTACAATTCACGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016780.1-634s1c1
Sequence:CCGGCCCTGTTACAATATGAAGAATCTCGAGATTCTTCATATTGTAACAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016780.2-1107s21c1
Sequence:CCGGGTCAGCCTTTACCAGAATTATCTCGAGATAATTCTGGTAAAGGCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016780.2-1341s21c1
Sequence:CCGGGACACGGTGAGCTTTAGTATCCTCGAGGATACTAAAGCTCACCGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016780.2-913s21c1
Sequence:CCGGCGGATGCCAAGACCCATATTGCTCGAGCAATATGGGTCTTGGCATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016780.2-434s21c1
Sequence:CCGGTCGACTACGGCCAGATGATTCCTCGAGGAATCATCTGGCCGTAGTCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016780.2-2576s21c1
Sequence:CCGGGCTGGAAGAATGTCAGTATGTCTCGAGACATACTGACATTCTTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016780.2-2145s21c1
Sequence:CCGGGATGACTGTGTCGTCAGATTCCTCGAGGAATCTGACGACACAGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016780.2-2604s21c1
Sequence:CCGGTATCTCTCTGTGTGTACTTATCTCGAGATAAGTACACACAGAGAGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016780
VALIDATED
ITGB3 MISSION shRNA shRNA Plasmid DNA
integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009616    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016780.1-2440s1c1
Sequence:CCGGCATTATGTTTACAGAGGACAACTCGAGTTGTCCTCTGTAAACATAATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016780.1-2244s1c1
Sequence:CCGGGCTCATCTGGAAGCTACTCATCTCGAGATGAGTAGCTTCCAGATGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016780.1-832s1c1
Sequence:CCGGGCATCCCATTTGCTAGTGTTTCTCGAGAAACACTAGCAAATGGGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016780.1-2061s1c1
Sequence:CCGGCGCCGTGAATTGTACCTACAACTCGAGTTGTAGGTACAATTCACGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016780.1-634s1c1
Sequence:CCGGCCCTGTTACAATATGAAGAATCTCGAGATTCTTCATATTGTAACAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016780.2-1107s21c1
Sequence:CCGGGTCAGCCTTTACCAGAATTATCTCGAGATAATTCTGGTAAAGGCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016780.2-1341s21c1
Sequence:CCGGGACACGGTGAGCTTTAGTATCCTCGAGGATACTAAAGCTCACCGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016780.2-913s21c1
Sequence:CCGGCGGATGCCAAGACCCATATTGCTCGAGCAATATGGGTCTTGGCATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016780.2-434s21c1
Sequence:CCGGTCGACTACGGCCAGATGATTCCTCGAGGAATCATCTGGCCGTAGTCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016780.2-2576s21c1
Sequence:CCGGGCTGGAAGAATGTCAGTATGTCTCGAGACATACTGACATTCTTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016780.2-2145s21c1
Sequence:CCGGGATGACTGTGTCGTCAGATTCCTCGAGGAATCTGACGACACAGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016780.2-2604s21c1
Sequence:CCGGTATCTCTCTGTGTGTACTTATCTCGAGATAAGTACACACAGAGAGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016780
VALIDATED
ITGB3 MISSION shRNA Lentiviral Transduction Particles
integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009616    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016780.1-2440s1c1
Sequence:CCGGCATTATGTTTACAGAGGACAACTCGAGTTGTCCTCTGTAAACATAATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016780.1-2244s1c1
Sequence:CCGGGCTCATCTGGAAGCTACTCATCTCGAGATGAGTAGCTTCCAGATGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016780.1-832s1c1
Sequence:CCGGGCATCCCATTTGCTAGTGTTTCTCGAGAAACACTAGCAAATGGGATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016780.1-2061s1c1
Sequence:CCGGCGCCGTGAATTGTACCTACAACTCGAGTTGTAGGTACAATTCACGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016780.1-634s1c1
Sequence:CCGGCCCTGTTACAATATGAAGAATCTCGAGATTCTTCATATTGTAACAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016780.2-1107s21c1
Sequence:CCGGGTCAGCCTTTACCAGAATTATCTCGAGATAATTCTGGTAAAGGCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016780.2-1341s21c1
Sequence:CCGGGACACGGTGAGCTTTAGTATCCTCGAGGATACTAAAGCTCACCGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016780.2-913s21c1
Sequence:CCGGCGGATGCCAAGACCCATATTGCTCGAGCAATATGGGTCTTGGCATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016780.2-434s21c1
Sequence:CCGGTCGACTACGGCCAGATGATTCCTCGAGGAATCATCTGGCCGTAGTCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016780.2-2576s21c1
Sequence:CCGGGCTGGAAGAATGTCAGTATGTCTCGAGACATACTGACATTCTTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016780.2-2145s21c1
Sequence:CCGGGATGACTGTGTCGTCAGATTCCTCGAGGAATCTGACGACACAGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016780.2-2604s21c1
Sequence:CCGGTATCTCTCTGTGTGTACTTATCTCGAGATAAGTACACACAGAGAGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000212
VALIDATED
ITGB3 MISSION shRNA Bacterial Glycerol Stock
integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000212.x-855s1c1
Sequence:CCGGCTCATATAGCATTGGACGGAACTCGAGTTCCGTCCAATGCTATATGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000212.x-2045s1c1
Sequence:CCGGGATGCAGTGAATTGTACCTATCTCGAGATAGGTACAATTCACTGCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003236    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000212.x-2632s1c1
Sequence:CCGGCCTTAGCCTTTGTCCCAGAATCTCGAGATTCTGGGACAAAGGCTAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000212.x-2343s1c1
Sequence:CCGGCCACGTCTACCTTCACCAATACTCGAGTATTGGTGAAGGTAGACGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000212.x-2084s1c1
Sequence:CCGGGTCGTCAGATTCCAGTACTATCTCGAGATAGTACTGGAATCTGACGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000212.2-2088s21c1
Sequence:CCGGGTCGTCAGATTCCAGTACTATCTCGAGATAGTACTGGAATCTGACGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000212.2-2347s21c1
Sequence:CCGGCCACGTCTACCTTCACCAATACTCGAGTATTGGTGAAGGTAGACGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000212.2-2636s21c1
Sequence:CCGGCCTTAGCCTTTGTCCCAGAATCTCGAGATTCTGGGACAAAGGCTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000212.2-2049s21c1
Sequence:CCGGGATGCAGTGAATTGTACCTATCTCGAGATAGGTACAATTCACTGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000212
VALIDATED
ITGB3 MISSION shRNA shRNA Plasmid DNA
integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000212.x-855s1c1
Sequence:CCGGCTCATATAGCATTGGACGGAACTCGAGTTCCGTCCAATGCTATATGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000212.x-2045s1c1
Sequence:CCGGGATGCAGTGAATTGTACCTATCTCGAGATAGGTACAATTCACTGCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003236    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000212.x-2632s1c1
Sequence:CCGGCCTTAGCCTTTGTCCCAGAATCTCGAGATTCTGGGACAAAGGCTAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000212.x-2343s1c1
Sequence:CCGGCCACGTCTACCTTCACCAATACTCGAGTATTGGTGAAGGTAGACGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000212.x-2084s1c1
Sequence:CCGGGTCGTCAGATTCCAGTACTATCTCGAGATAGTACTGGAATCTGACGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000212.2-2088s21c1
Sequence:CCGGGTCGTCAGATTCCAGTACTATCTCGAGATAGTACTGGAATCTGACGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000212.2-2347s21c1
Sequence:CCGGCCACGTCTACCTTCACCAATACTCGAGTATTGGTGAAGGTAGACGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000212.2-2636s21c1
Sequence:CCGGCCTTAGCCTTTGTCCCAGAATCTCGAGATTCTGGGACAAAGGCTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000212.2-2049s21c1
Sequence:CCGGGATGCAGTGAATTGTACCTATCTCGAGATAGGTACAATTCACTGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000212
VALIDATED
ITGB3 MISSION shRNA Lentiviral Transduction Particles
integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000212.x-855s1c1
Sequence:CCGGCTCATATAGCATTGGACGGAACTCGAGTTCCGTCCAATGCTATATGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000212.x-2045s1c1
Sequence:CCGGGATGCAGTGAATTGTACCTATCTCGAGATAGGTACAATTCACTGCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003236    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000212.x-2632s1c1
Sequence:CCGGCCTTAGCCTTTGTCCCAGAATCTCGAGATTCTGGGACAAAGGCTAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000212.x-2343s1c1
Sequence:CCGGCCACGTCTACCTTCACCAATACTCGAGTATTGGTGAAGGTAGACGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000212.x-2084s1c1
Sequence:CCGGGTCGTCAGATTCCAGTACTATCTCGAGATAGTACTGGAATCTGACGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000212.2-2088s21c1
Sequence:CCGGGTCGTCAGATTCCAGTACTATCTCGAGATAGTACTGGAATCTGACGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000212.2-2347s21c1
Sequence:CCGGCCACGTCTACCTTCACCAATACTCGAGTATTGGTGAAGGTAGACGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000212.2-2636s21c1
Sequence:CCGGCCTTAGCCTTTGTCCCAGAATCTCGAGATTCTGGGACAAAGGCTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000212.2-2049s21c1
Sequence:CCGGGATGCAGTGAATTGTACCTATCTCGAGATAGGTACAATTCACTGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)