EMAIL THIS PAGE TO A FRIEND

ITGB3BP

integrin beta 3 binding protein (beta3-endonexin)

115 Gene Product Result for
Synonyms: CENP-R CENPR HSU37139 NRIF3 TAP20
Gene ID:
Human(23421) Summary: This gene encodes a transcriptional coregulator that binds to and enhances the activity of members of the nuclear receptor families, thyroid hormone receptors and retinoid X receptors. This protein also acts as a corepressor of NF-kappaB-dependent signaling. This protein induces apoptosis in breast cancer cells through a caspase 2-mediated signaling pathway. This protein is also a component of the centromere-specific histone H3 variant nucleosome associated complex (CENP-NAC) and may be involved in mitotic progression by recruiting the histone H3 variant CENP-A to the centromere. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Mouse(67733) integrin beta 3 binding protein (beta3-endonexin)
Rat(362548) integrin beta 3 binding protein (beta3-endonexin)
chicken(424689) integrin beta 3 binding protein (beta3-endonexin)
dog(609967) integrin beta 3 binding protein (beta3-endonexin)
cow(614469) integrin beta 3 binding protein (beta3-endonexin)
domestic cat(101082676) integrin beta 3 binding protein (beta3-endonexin)
domestic guinea pig(100728578) integrin beta 3 binding protein (beta3-endonexin)
naked mole-rat(101712566) integrin beta 3 binding protein (beta3-endonexin)
sheep(101108702) integrin beta 3 binding protein (beta3-endonexin)
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026348 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026348 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026348 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014288 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014288 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014288 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU092721 MISSION® esiRNA esiRNA human ITGB3BP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014288 Rosetta Predictions human pricing
NM_001013213 Rosetta Predictions rat pricing
NM_026348 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014288 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238825 predicted 410
2 SASI_Hs01_00238826 predicted 368
3 SASI_Hs01_00238828 predicted 510
4 SASI_Hs01_00238829 predicted 361
5 SASI_Hs01_00238830 predicted 277
6 SASI_Hs01_00238831 predicted 638
7 SASI_Hs01_00238832 predicted 601
8 SASI_Hs01_00238833 predicted 582
9 SASI_Hs01_00238834 predicted 607
10 SASI_Hs02_00345375 predicted 444
11 SASI_Hs01_00238827 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013213 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032204 predicted 438
2 SASI_Rn01_00032205 predicted 543
3 SASI_Rn01_00032206 predicted 818
4 SASI_Rn01_00032207 predicted 581
5 SASI_Rn01_00032208 predicted 697
6 SASI_Rn01_00032209 predicted 340
7 SASI_Rn01_00032212 predicted 561
8 SASI_Rn01_00032213 predicted 472
9 SASI_Rn02_00201005 predicted 422
10 SASI_Rn02_00201006 predicted 348
11 SASI_Rn01_00032210 predicted 798
12 SASI_Rn01_00032211 predicted 666
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026348 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330068 predicted 437
2 SASI_Mm01_00178786 predicted 554
3 SASI_Mm01_00178787 predicted 692
4 SASI_Mm01_00178788 predicted 770
5 SASI_Mm01_00178789 predicted 397
6 SASI_Mm01_00178790 predicted 280
7 SASI_Mm01_00178792 predicted 634
8 SASI_Mm01_00178793 predicted 596
9 SASI_Mm01_00178794 predicted 210
10 SASI_Mm02_00330069 predicted 769
11 SASI_Mm01_00178785 predicted 441
12 SASI_Mm01_00178791 predicted 663
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026348
VALIDATED
ITGB3BP MISSION shRNA Bacterial Glycerol Stock
integrin beta 3 binding protein (beta3-endonexin)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026348.3-518s21c1
Sequence:CCGGCATCATCTTGACAGCTTTGAACTCGAGTTCAAAGCTGTCAAGATGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026348.3-215s21c1
Sequence:CCGGGAAACAAGGAAACGGAGTAACCTCGAGGTTACTCCGTTTCCTTGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026348.3-555s21c1
Sequence:CCGGTGAACTGAGTGTTACCTTCAACTCGAGTTGAAGGTAACACTCAGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026348.3-779s21c1
Sequence:CCGGGCTTATGAGTTCAGGTATATACTCGAGTATATACCTGAACTCATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026348.3-238s21c1
Sequence:CCGGGAGCTCACCTGTAAGACAGGACTCGAGTCCTGTCTTACAGGTGAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026348.2-1626s1c1
Sequence:CCGGGCACAGAAGAACGTGTGTAATCTCGAGATTACACACGTTCTTCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026348.2-194s1c1
Sequence:CCGGGCACAGAAACGGACCATCAAACTCGAGTTTGATGGTCCGTTTCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026348.2-279s1c1
Sequence:CCGGGATGGATTCATGGTGTTGCTACTCGAGTAGCAACACCATGAATCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026348.2-519s1c1
Sequence:CCGGCATCATCTTGACAGCTTTGAACTCGAGTTCAAAGCTGTCAAGATGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026348.2-406s1c1
Sequence:CCGGCCCTAGTACCATGCTCCTTAACTCGAGTTAAGGAGCATGGTACTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026348
VALIDATED
ITGB3BP MISSION shRNA shRNA Plasmid DNA
integrin beta 3 binding protein (beta3-endonexin)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026348.3-518s21c1
Sequence:CCGGCATCATCTTGACAGCTTTGAACTCGAGTTCAAAGCTGTCAAGATGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026348.3-215s21c1
Sequence:CCGGGAAACAAGGAAACGGAGTAACCTCGAGGTTACTCCGTTTCCTTGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026348.3-555s21c1
Sequence:CCGGTGAACTGAGTGTTACCTTCAACTCGAGTTGAAGGTAACACTCAGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026348.3-779s21c1
Sequence:CCGGGCTTATGAGTTCAGGTATATACTCGAGTATATACCTGAACTCATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026348.3-238s21c1
Sequence:CCGGGAGCTCACCTGTAAGACAGGACTCGAGTCCTGTCTTACAGGTGAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026348.2-1626s1c1
Sequence:CCGGGCACAGAAGAACGTGTGTAATCTCGAGATTACACACGTTCTTCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026348.2-194s1c1
Sequence:CCGGGCACAGAAACGGACCATCAAACTCGAGTTTGATGGTCCGTTTCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026348.2-279s1c1
Sequence:CCGGGATGGATTCATGGTGTTGCTACTCGAGTAGCAACACCATGAATCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026348.2-519s1c1
Sequence:CCGGCATCATCTTGACAGCTTTGAACTCGAGTTCAAAGCTGTCAAGATGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026348.2-406s1c1
Sequence:CCGGCCCTAGTACCATGCTCCTTAACTCGAGTTAAGGAGCATGGTACTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026348
VALIDATED
ITGB3BP MISSION shRNA Lentiviral Transduction Particles
integrin beta 3 binding protein (beta3-endonexin)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026348.3-518s21c1
Sequence:CCGGCATCATCTTGACAGCTTTGAACTCGAGTTCAAAGCTGTCAAGATGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026348.3-215s21c1
Sequence:CCGGGAAACAAGGAAACGGAGTAACCTCGAGGTTACTCCGTTTCCTTGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026348.3-555s21c1
Sequence:CCGGTGAACTGAGTGTTACCTTCAACTCGAGTTGAAGGTAACACTCAGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026348.3-779s21c1
Sequence:CCGGGCTTATGAGTTCAGGTATATACTCGAGTATATACCTGAACTCATAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026348.3-238s21c1
Sequence:CCGGGAGCTCACCTGTAAGACAGGACTCGAGTCCTGTCTTACAGGTGAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026348.2-1626s1c1
Sequence:CCGGGCACAGAAGAACGTGTGTAATCTCGAGATTACACACGTTCTTCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026348.2-194s1c1
Sequence:CCGGGCACAGAAACGGACCATCAAACTCGAGTTTGATGGTCCGTTTCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026348.2-279s1c1
Sequence:CCGGGATGGATTCATGGTGTTGCTACTCGAGTAGCAACACCATGAATCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026348.2-519s1c1
Sequence:CCGGCATCATCTTGACAGCTTTGAACTCGAGTTCAAAGCTGTCAAGATGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026348.2-406s1c1
Sequence:CCGGCCCTAGTACCATGCTCCTTAACTCGAGTTAAGGAGCATGGTACTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014288
VALIDATED
ITGB3BP MISSION shRNA Bacterial Glycerol Stock
integrin beta 3 binding protein (beta3-endonexin)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014288.3-659s21c1
Sequence:CCGGCCCAGTAAATACCAGCTCGTACTCGAGTACGAGCTGGTATTTACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014288.3-193s21c1
Sequence:CCGGGCACAGAAATGGACTATCAAACTCGAGTTTGATAGTCCATTTCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014288.3-521s21c1
Sequence:CCGGCGTCATCTTGACAGCTATGAACTCGAGTTCATAGCTGTCAAGATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014288.3-143s21c1
Sequence:CCGGACTTGTCAAATGAGTCTATTTCTCGAGAAATAGACTCATTTGACAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014288.3-495s21c1
Sequence:CCGGGTACAGGACTTCCTCACAAAGCTCGAGCTTTGTGAGGAAGTCCTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014288.3-170s1c1
Sequence:CCGGCCCACAAGTTCTGAAGAGCAACTCGAGTTGCTCTTCAGAACTTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014288.3-521s1c1
Sequence:CCGGCGTCATCTTGACAGCTATGAACTCGAGTTCATAGCTGTCAAGATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014288.3-239s1c1
Sequence:CCGGCCCAGTTTAACTGAAAGCAAACTCGAGTTTGCTTTCAGTTAAACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014288.3-193s1c1
Sequence:CCGGGCACAGAAATGGACTATCAAACTCGAGTTTGATAGTCCATTTCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014288.3-659s1c1
Sequence:CCGGCCCAGTAAATACCAGCTCGTACTCGAGTACGAGCTGGTATTTACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014288
VALIDATED
ITGB3BP MISSION shRNA shRNA Plasmid DNA
integrin beta 3 binding protein (beta3-endonexin)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014288.3-659s21c1
Sequence:CCGGCCCAGTAAATACCAGCTCGTACTCGAGTACGAGCTGGTATTTACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014288.3-193s21c1
Sequence:CCGGGCACAGAAATGGACTATCAAACTCGAGTTTGATAGTCCATTTCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014288.3-521s21c1
Sequence:CCGGCGTCATCTTGACAGCTATGAACTCGAGTTCATAGCTGTCAAGATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014288.3-143s21c1
Sequence:CCGGACTTGTCAAATGAGTCTATTTCTCGAGAAATAGACTCATTTGACAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014288.3-495s21c1
Sequence:CCGGGTACAGGACTTCCTCACAAAGCTCGAGCTTTGTGAGGAAGTCCTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014288.3-170s1c1
Sequence:CCGGCCCACAAGTTCTGAAGAGCAACTCGAGTTGCTCTTCAGAACTTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014288.3-521s1c1
Sequence:CCGGCGTCATCTTGACAGCTATGAACTCGAGTTCATAGCTGTCAAGATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014288.3-239s1c1
Sequence:CCGGCCCAGTTTAACTGAAAGCAAACTCGAGTTTGCTTTCAGTTAAACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014288.3-193s1c1
Sequence:CCGGGCACAGAAATGGACTATCAAACTCGAGTTTGATAGTCCATTTCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014288.3-659s1c1
Sequence:CCGGCCCAGTAAATACCAGCTCGTACTCGAGTACGAGCTGGTATTTACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014288
VALIDATED
ITGB3BP MISSION shRNA Lentiviral Transduction Particles
integrin beta 3 binding protein (beta3-endonexin)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014288.3-659s21c1
Sequence:CCGGCCCAGTAAATACCAGCTCGTACTCGAGTACGAGCTGGTATTTACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014288.3-193s21c1
Sequence:CCGGGCACAGAAATGGACTATCAAACTCGAGTTTGATAGTCCATTTCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014288.3-521s21c1
Sequence:CCGGCGTCATCTTGACAGCTATGAACTCGAGTTCATAGCTGTCAAGATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014288.3-143s21c1
Sequence:CCGGACTTGTCAAATGAGTCTATTTCTCGAGAAATAGACTCATTTGACAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014288.3-495s21c1
Sequence:CCGGGTACAGGACTTCCTCACAAAGCTCGAGCTTTGTGAGGAAGTCCTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014288.3-170s1c1
Sequence:CCGGCCCACAAGTTCTGAAGAGCAACTCGAGTTGCTCTTCAGAACTTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014288.3-521s1c1
Sequence:CCGGCGTCATCTTGACAGCTATGAACTCGAGTTCATAGCTGTCAAGATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014288.3-239s1c1
Sequence:CCGGCCCAGTTTAACTGAAAGCAAACTCGAGTTTGCTTTCAGTTAAACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014288.3-193s1c1
Sequence:CCGGGCACAGAAATGGACTATCAAACTCGAGTTTGATAGTCCATTTCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014288.3-659s1c1
Sequence:CCGGCCCAGTAAATACCAGCTCGTACTCGAGTACGAGCTGGTATTTACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)