EMAIL THIS PAGE TO A FRIEND

ITGB4

integrin, beta 4

105 Gene Product Result for
Synonyms: CD104
Gene ID:
Human(3691) Summary: Integrins are heterodimers comprised of alpha and beta subunits, that are noncovalently associated transmembrane glycoprotein receptors. Different combinations of alpha and beta polypeptides form complexes that vary in their ligand-binding specificities. Integrins mediate cell-matrix or cell-cell adhesion, and transduced signals that regulate gene expression and cell growth. This gene encodes the integrin beta 4 subunit, a receptor for the laminins. This subunit tends to associate with alpha 6 subunit and is likely to play a pivotal role in the biology of invasive carcinoma. Mutations in this gene are associated with epidermolysis bullosa with pyloric atresia. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(192897) integrin beta 4
Rat(25724) integrin, beta 4
sheep(101119919) integrin, beta 4
naked mole-rat(101697313) integrin, beta 4
Zebrafish(335269) integrin, beta 4
cow(506995) integrin, beta 4
Horse(100051679) integrin, beta 4
chicken(417374) integrin, beta 4
dog(483318) integrin, beta 4
domestic cat(101080415) integrin, beta 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000213 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000213 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000213 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_109756 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_109756 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_109756 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000213 Rosetta Predictions human pricing
NM_001005619 Rosetta Predictions human pricing
NM_001005731 Rosetta Predictions human pricing
NM_013180 Rosetta Predictions rat pricing
NM_001005607 Rosetta Predictions mouse pricing
NM_001005608 Rosetta Predictions mouse pricing
NM_133663 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000213 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230929 predicted 2434
2 SASI_Hs01_00230930 predicted 696
3 SASI_Hs01_00230931 predicted 3980
4 SASI_Hs01_00230932 predicted 2451
5 SASI_Hs01_00230933 predicted 5631
6 SASI_Hs01_00230935 predicted 3670
7 SASI_Hs02_00302101 predicted 1777
8 SASI_Hs01_00230936 predicted 2451
9 SASI_Hs01_00230937 predicted 2127
10 SASI_Hs01_00230938 predicted 5377
11 SASI_Hs01_00230934 predicted 3748
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005619 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100341 predicted 2258
2 SASI_Hs01_00100342 predicted 518
3 SASI_Hs01_00100343 predicted 3798
4 SASI_Hs01_00100344 predicted 2265
5 SASI_Hs01_00100345 predicted 5402
6 SASI_Hs01_00100347 predicted 3492
7 SASI_Hs02_00304997 predicted 1597
8 SASI_Hs01_00100348 predicted 2271
9 SASI_Hs01_00100349 predicted 1955
10 SASI_Hs01_00100350 predicted 5152
11 SASI_Hs01_00100346 predicted 3576
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005731 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044407 predicted 2435
2 SASI_Hs01_00044408 predicted 692
3 SASI_Hs01_00044409 predicted 3980
4 SASI_Hs01_00044410 predicted 2445
5 SASI_Hs01_00044411 predicted 5425
6 SASI_Hs01_00044413 predicted 3665
7 SASI_Hs02_00304998 predicted 1781
8 SASI_Hs01_00044414 predicted 2451
9 SASI_Hs01_00044415 predicted 2131
10 SASI_Hs01_00044416 predicted 5173
11 SASI_Hs01_00044412 predicted 3752
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013180 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261009 predicted 5594
2 SASI_Rn01_00053287 predicted 2474
3 SASI_Rn01_00053288 predicted 460
4 SASI_Rn01_00053289 predicted 3766
5 SASI_Rn01_00053290 predicted 2157
6 SASI_Rn02_00261010 predicted 3145
7 SASI_Rn01_00053292 predicted 3276
8 SASI_Rn01_00053293 predicted 3820
9 SASI_Rn01_00053294 predicted 287
10 SASI_Rn01_00053295 predicted 2045
11 SASI_Rn01_00053291 predicted 2853
12 SASI_Rn01_00053296 predicted 5149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005607 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125147 predicted 2460
2 SASI_Mm01_00125148 predicted 2244
3 SASI_Mm01_00125149 predicted 1180
4 SASI_Mm01_00125150 predicted 1164
5 SASI_Mm01_00125151 predicted 1436
6 SASI_Mm01_00125152 predicted 2838
7 SASI_Mm01_00125153 predicted 535
8 SASI_Mm01_00125154 predicted 2469
9 SASI_Mm01_00125155 predicted 2036
10 SASI_Mm01_00125156 predicted 1032
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005608 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286640 predicted 5814
2 SASI_Mm01_00064666 predicted 2701
3 SASI_Mm02_00286641 predicted 5564
4 SASI_Mm02_00286642 predicted 3993
5 SASI_Mm01_00064668 predicted 1427
6 SASI_Mm01_00064669 predicted 1412
7 SASI_Mm01_00064671 predicted 3078
8 SASI_Mm01_00064672 predicted 790
9 SASI_Mm01_00064673 predicted 2715
10 SASI_Mm02_00286643 predicted 2721
11 SASI_Mm01_00064667 predicted 2238
12 SASI_Mm01_00064670 predicted 1434
13 SASI_Mm01_00064674 predicted 2039
14 SASI_Mm01_00064675 predicted 1032
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133663 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338596 predicted 5665
2 SASI_Mm01_00100174 predicted 2709
3 SASI_Mm02_00338597 predicted 5408
4 SASI_Mm02_00338598 predicted 4002
5 SASI_Mm01_00100176 predicted 1429
6 SASI_Mm01_00100177 predicted 1416
7 SASI_Mm01_00100179 predicted 3084
8 SASI_Mm01_00100180 predicted 788
9 SASI_Mm01_00100181 predicted 2709
10 SASI_Mm02_00338599 predicted 2718
11 SASI_Mm01_00100175 predicted 2239
12 SASI_Mm01_00100178 predicted 1436
13 SASI_Mm01_00100182 predicted 2030
14 SASI_Mm01_00100183 predicted 1042
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000213
VALIDATED
ITGB4 MISSION shRNA Bacterial Glycerol Stock
integrin, beta 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000213.3-5024s1c1
Sequence:CCGGGAGGGTGTCATCACCATTGAACTCGAGTTCAATGGTGATGACACCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000213.3-5719s1c1
Sequence:CCGGCTCCTCAGCTACTCCATCCTTCTCGAGAAGGATGGAGTAGCTGAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000213.3-3992s1c1
Sequence:CCGGCCCATGAAGAAAGTGCTGGTTCTCGAGAACCAGCACTTTCTTCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000213.3-678s1c1
Sequence:CCGGCCAGCGACTACACTATTGGATCTCGAGATCCAATAGTGTAGTCGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_000213.3-3744s21c1
Sequence:CCGGTGTACCCGTATTGCGACTATGCTCGAGCATAGTCGCAATACGGGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000213.3-824s21c1
Sequence:CCGGGTGGATGAGTTCCGGAATAAACTCGAGTTTATTCCGGAACTCATCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_000213.3-5024s21c1
Sequence:CCGGGAGGGTGTCATCACCATTGAACTCGAGTTCAATGGTGATGACACCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_000213.3-3969s21c1
Sequence:CCGGACGATGACAACCGACCTATTGCTCGAGCAATAGGTCGGTTGTCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000213.3-1187s21c1
Sequence:CCGGGAGAAGCTTCACACCTATTTCCTCGAGGAAATAGGTGTGAAGCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000213
VALIDATED
ITGB4 MISSION shRNA shRNA Plasmid DNA
integrin, beta 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000213.3-5024s1c1
Sequence:CCGGGAGGGTGTCATCACCATTGAACTCGAGTTCAATGGTGATGACACCCTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000057768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000213.3-5719s1c1
Sequence:CCGGCTCCTCAGCTACTCCATCCTTCTCGAGAAGGATGGAGTAGCTGAGGAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000057769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000213.3-3992s1c1
Sequence:CCGGCCCATGAAGAAAGTGCTGGTTCTCGAGAACCAGCACTTTCTTCATGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000057770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000213.3-678s1c1
Sequence:CCGGCCAGCGACTACACTATTGGATCTCGAGATCCAATAGTGTAGTCGCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000308077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_000213.3-3744s21c1
Sequence:CCGGTGTACCCGTATTGCGACTATGCTCGAGCATAGTCGCAATACGGGTACATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000296113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000213.3-824s21c1
Sequence:CCGGGTGGATGAGTTCCGGAATAAACTCGAGTTTATTCCGGAACTCATCCACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000306738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_000213.3-5024s21c1
Sequence:CCGGGAGGGTGTCATCACCATTGAACTCGAGTTCAATGGTGATGACACCCTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000296114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_000213.3-3969s21c1
Sequence:CCGGACGATGACAACCGACCTATTGCTCGAGCAATAGGTCGGTTGTCATCGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000296112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000213.3-1187s21c1
Sequence:CCGGGAGAAGCTTCACACCTATTTCCTCGAGGAAATAGGTGTGAAGCTTCTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000213
VALIDATED
ITGB4 MISSION shRNA Lentiviral Transduction Particles
integrin, beta 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000213.3-5024s1c1
Sequence:CCGGGAGGGTGTCATCACCATTGAACTCGAGTTCAATGGTGATGACACCCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000213.3-5719s1c1
Sequence:CCGGCTCCTCAGCTACTCCATCCTTCTCGAGAAGGATGGAGTAGCTGAGGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000213.3-3992s1c1
Sequence:CCGGCCCATGAAGAAAGTGCTGGTTCTCGAGAACCAGCACTTTCTTCATGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000213.3-678s1c1
Sequence:CCGGCCAGCGACTACACTATTGGATCTCGAGATCCAATAGTGTAGTCGCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_000213.3-3744s21c1
Sequence:CCGGTGTACCCGTATTGCGACTATGCTCGAGCATAGTCGCAATACGGGTACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000213.3-824s21c1
Sequence:CCGGGTGGATGAGTTCCGGAATAAACTCGAGTTTATTCCGGAACTCATCCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_000213.3-5024s21c1
Sequence:CCGGGAGGGTGTCATCACCATTGAACTCGAGTTCAATGGTGATGACACCCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_000213.3-3969s21c1
Sequence:CCGGACGATGACAACCGACCTATTGCTCGAGCAATAGGTCGGTTGTCATCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000213.3-1187s21c1
Sequence:CCGGGAGAAGCTTCACACCTATTTCCTCGAGGAAATAGGTGTGAAGCTTCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_109756
VALIDATED
ITGB4 MISSION shRNA Bacterial Glycerol Stock
integrin, beta 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109756.3-3585s1c1
Sequence:CCGGCCACCGTTATTCTCGATGAAACTCGAGTTTCATCGAGAATAACGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109756.3-2326s1c1
Sequence:CCGGCGACTGCACTTACAGCTACAACTCGAGTTGTAGCTGTAAGTGCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109756.3-679s1c1
Sequence:CCGGCGTGGATCTGTATATCCTCATCTCGAGATGAGGATATACAGATCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109756.3-4124s1c1
Sequence:CCGGCGGATGCTGCTCATTGAGAATCTCGAGATTCTCAATGAGCAGCATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109756.3-1336s1c1
Sequence:CCGGGCAGGAGGATTCATCCAACATCTCGAGATGTTGGATGAATCCTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_109756
VALIDATED
ITGB4 MISSION shRNA shRNA Plasmid DNA
integrin, beta 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109756.3-3585s1c1
Sequence:CCGGCCACCGTTATTCTCGATGAAACTCGAGTTTCATCGAGAATAACGGTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000066874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109756.3-2326s1c1
Sequence:CCGGCGACTGCACTTACAGCTACAACTCGAGTTGTAGCTGTAAGTGCAGTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000066877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109756.3-679s1c1
Sequence:CCGGCGTGGATCTGTATATCCTCATCTCGAGATGAGGATATACAGATCCACGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000066876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109756.3-4124s1c1
Sequence:CCGGCGGATGCTGCTCATTGAGAATCTCGAGATTCTCAATGAGCAGCATCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000066875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109756.3-1336s1c1
Sequence:CCGGGCAGGAGGATTCATCCAACATCTCGAGATGTTGGATGAATCCTCCTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_109756
VALIDATED
ITGB4 MISSION shRNA Lentiviral Transduction Particles
integrin, beta 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109756.3-3585s1c1
Sequence:CCGGCCACCGTTATTCTCGATGAAACTCGAGTTTCATCGAGAATAACGGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109756.3-2326s1c1
Sequence:CCGGCGACTGCACTTACAGCTACAACTCGAGTTGTAGCTGTAAGTGCAGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109756.3-679s1c1
Sequence:CCGGCGTGGATCTGTATATCCTCATCTCGAGATGAGGATATACAGATCCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109756.3-4124s1c1
Sequence:CCGGCGGATGCTGCTCATTGAGAATCTCGAGATTCTCAATGAGCAGCATCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109756.3-1336s1c1
Sequence:CCGGGCAGGAGGATTCATCCAACATCTCGAGATGTTGGATGAATCCTCCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)