EMAIL THIS PAGE TO A FRIEND

ITGB5

integrin, beta 5

62 Gene Product Result for
UniProtKB ID: P18084, B0LPF8, B2RD70
Gene ID:
Mouse(16419) integrin beta 5
Rat(257645) integrin, beta 5
Zebrafish(563556) integrin, beta 5
cow(282564) integrin, beta 5
domestic cat(101101247) integrin, beta 5
dog(608977) integrin, beta 5
chicken(395142) integrin, beta 5
naked mole-rat(101702445) integrin, beta 5
sheep(101120887) integrin, beta 5
Domestic Rabbit(100353546) integrin, beta 5
sheep(443142) integrin, beta 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010580 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010580 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010580 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002213 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002213 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002213 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002213 Rosetta Predictions human pricing
NM_147139 Rosetta Predictions rat pricing
NM_010580 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002213 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333438 predicted 2583
2 SASI_Hs01_00093439 predicted 1431
3 SASI_Hs02_00333439 predicted 1733
4 SASI_Hs01_00093440 predicted 1069
5 SASI_Hs01_00093441 predicted 2667
6 SASI_Hs01_00093442 predicted 1355
7 SASI_Hs01_00093443 predicted 1414
8 SASI_Hs01_00093444 predicted 981
9 SASI_Hs01_00093445 predicted 2269
10 SASI_Hs01_00093446 predicted 2506
11 SASI_Hs01_00093438 predicted 2591
12 SASI_Hs01_00093447 predicted 2614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147139 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268838 predicted 822
2 SASI_Rn02_00268839 predicted 2133
3 SASI_Rn02_00268840 predicted 2544
4 SASI_Rn02_00268841 predicted 2295
5 SASI_Rn02_00268842 predicted 2102
6 SASI_Rn02_00268843 predicted 2417
7 SASI_Rn02_00268844 predicted 645
8 SASI_Rn02_00268845 predicted 1091
9 SASI_Rn02_00268846 predicted 1152
10 SASI_Rn02_00268847 predicted 1055
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010580 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318862 predicted 517
2 SASI_Mm01_00170083 predicted 1371
3 SASI_Mm01_00170084 predicted 802
4 SASI_Mm01_00170087 predicted 1120
5 SASI_Mm01_00170088 predicted 1242
6 SASI_Mm01_00170089 predicted 1303
7 SASI_Mm01_00170090 predicted 2515
8 SASI_Mm01_00170091 predicted 2663
9 SASI_Mm01_00170092 predicted 2544
10 SASI_Mm02_00318863 predicted 2542
11 SASI_Mm01_00170085 predicted 2255
12 SASI_Mm01_00170086 predicted 1782
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010580
VALIDATED
ITGB5 MISSION shRNA Bacterial Glycerol Stock
integrin, beta 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010580.2-2622s21c1
Sequence:CCGGCGCCTTCAACAAGTTCAACAACTCGAGTTGTTGAACTTGTTGAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010580.2-401s21c1
Sequence:CCGGGTGTGAAGAATGCCTGTTGATCTCGAGATCAACAGGCATTCTTCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010580.2-898s21c1
Sequence:CCGGCGTGTATTGGTTACAAGTTATCTCGAGATAACTTGTAACCAATACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010580.2-1271s21c1
Sequence:CCGGGCTGGCAGAGAACAATATCAACTCGAGTTGATATTGTTCTCTGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010580.2-2550s21c1
Sequence:CCGGCGAGAGTTTGCCAAGTTCCAACTCGAGTTGGAACTTGGCAAACTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010580.1-306s1c1
Sequence:CCGGGTGTGAAGAATGCCTGTTGATCTCGAGATCAACAGGCATTCTTCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010580.1-2527s1c1
Sequence:CCGGCGCCTTCAACAAGTTCAACAACTCGAGTTGTTGAACTTGTTGAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010580.1-1176s1c1
Sequence:CCGGGCTGGCAGAGAACAATATCAACTCGAGTTGATATTGTTCTCTGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010580.1-803s1c1
Sequence:CCGGCGTGTATTGGTTACAAGTTATCTCGAGATAACTTGTAACCAATACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010580.1-2455s1c1
Sequence:CCGGCGAGAGTTTGCCAAGTTCCAACTCGAGTTGGAACTTGGCAAACTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010580
VALIDATED
ITGB5 MISSION shRNA shRNA Plasmid DNA
integrin, beta 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010580.2-2622s21c1
Sequence:CCGGCGCCTTCAACAAGTTCAACAACTCGAGTTGTTGAACTTGTTGAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010580.2-401s21c1
Sequence:CCGGGTGTGAAGAATGCCTGTTGATCTCGAGATCAACAGGCATTCTTCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010580.2-898s21c1
Sequence:CCGGCGTGTATTGGTTACAAGTTATCTCGAGATAACTTGTAACCAATACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010580.2-1271s21c1
Sequence:CCGGGCTGGCAGAGAACAATATCAACTCGAGTTGATATTGTTCTCTGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010580.2-2550s21c1
Sequence:CCGGCGAGAGTTTGCCAAGTTCCAACTCGAGTTGGAACTTGGCAAACTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010580.1-306s1c1
Sequence:CCGGGTGTGAAGAATGCCTGTTGATCTCGAGATCAACAGGCATTCTTCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010580.1-2527s1c1
Sequence:CCGGCGCCTTCAACAAGTTCAACAACTCGAGTTGTTGAACTTGTTGAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010580.1-1176s1c1
Sequence:CCGGGCTGGCAGAGAACAATATCAACTCGAGTTGATATTGTTCTCTGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010580.1-803s1c1
Sequence:CCGGCGTGTATTGGTTACAAGTTATCTCGAGATAACTTGTAACCAATACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010580.1-2455s1c1
Sequence:CCGGCGAGAGTTTGCCAAGTTCCAACTCGAGTTGGAACTTGGCAAACTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010580
VALIDATED
ITGB5 MISSION shRNA Lentiviral Transduction Particles
integrin, beta 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010580.2-2622s21c1
Sequence:CCGGCGCCTTCAACAAGTTCAACAACTCGAGTTGTTGAACTTGTTGAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010580.2-401s21c1
Sequence:CCGGGTGTGAAGAATGCCTGTTGATCTCGAGATCAACAGGCATTCTTCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010580.2-898s21c1
Sequence:CCGGCGTGTATTGGTTACAAGTTATCTCGAGATAACTTGTAACCAATACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010580.2-1271s21c1
Sequence:CCGGGCTGGCAGAGAACAATATCAACTCGAGTTGATATTGTTCTCTGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010580.2-2550s21c1
Sequence:CCGGCGAGAGTTTGCCAAGTTCCAACTCGAGTTGGAACTTGGCAAACTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010580.1-306s1c1
Sequence:CCGGGTGTGAAGAATGCCTGTTGATCTCGAGATCAACAGGCATTCTTCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010580.1-2527s1c1
Sequence:CCGGCGCCTTCAACAAGTTCAACAACTCGAGTTGTTGAACTTGTTGAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010580.1-1176s1c1
Sequence:CCGGGCTGGCAGAGAACAATATCAACTCGAGTTGATATTGTTCTCTGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010580.1-803s1c1
Sequence:CCGGCGTGTATTGGTTACAAGTTATCTCGAGATAACTTGTAACCAATACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010580.1-2455s1c1
Sequence:CCGGCGAGAGTTTGCCAAGTTCCAACTCGAGTTGGAACTTGGCAAACTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002213
VALIDATED
ITGB5 MISSION shRNA Bacterial Glycerol Stock
integrin, beta 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002213.3-493s21c1
Sequence:CCGGCTGAGGGCAAACCTTGTCAAACTCGAGTTTGACAAGGTTTGCCCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296117    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_002213.3-2970s21c1
Sequence:CCGGAGCTTGTTGTCCCAATGAAATCTCGAGATTTCATTGGGACAACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_002213.3-1458s21c1
Sequence:CCGGGGATCAGCCTGAGGATCTTAACTCGAGTTAAGATCCTCAGGCTGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_002213.3-359s21c1
Sequence:CCGGGGCTCGCAGGTCTCAACATATCTCGAGATATGTTGAGACCTGCGAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002213.3-1225s21c1
Sequence:CCGGGCATCCAACCAGATGGACTATCTCGAGATAGTCCATCTGGTTGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002213.3-2588s1c1
Sequence:CCGGCCCGCTATGAAATGGCTTCAACTCGAGTTGAAGCCATTTCATAGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002213.3-1225s1c1
Sequence:CCGGGCATCCAACCAGATGGACTATCTCGAGATAGTCCATCTGGTTGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002213.3-2332s1c1
Sequence:CCGGGCTGTGCTATGTTTCTACAAACTCGAGTTTGTAGAAACATAGCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002213.3-1140s1c1
Sequence:CCGGCCACATCGCATTGGATGGAAACTCGAGTTTCCATCCAATGCGATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002213
VALIDATED
ITGB5 MISSION shRNA shRNA Plasmid DNA
integrin, beta 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002213.3-493s21c1
Sequence:CCGGCTGAGGGCAAACCTTGTCAAACTCGAGTTTGACAAGGTTTGCCCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296117    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_002213.3-2970s21c1
Sequence:CCGGAGCTTGTTGTCCCAATGAAATCTCGAGATTTCATTGGGACAACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_002213.3-1458s21c1
Sequence:CCGGGGATCAGCCTGAGGATCTTAACTCGAGTTAAGATCCTCAGGCTGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_002213.3-359s21c1
Sequence:CCGGGGCTCGCAGGTCTCAACATATCTCGAGATATGTTGAGACCTGCGAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002213.3-1225s21c1
Sequence:CCGGGCATCCAACCAGATGGACTATCTCGAGATAGTCCATCTGGTTGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002213.3-2588s1c1
Sequence:CCGGCCCGCTATGAAATGGCTTCAACTCGAGTTGAAGCCATTTCATAGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002213.3-1225s1c1
Sequence:CCGGGCATCCAACCAGATGGACTATCTCGAGATAGTCCATCTGGTTGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002213.3-2332s1c1
Sequence:CCGGGCTGTGCTATGTTTCTACAAACTCGAGTTTGTAGAAACATAGCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002213.3-1140s1c1
Sequence:CCGGCCACATCGCATTGGATGGAAACTCGAGTTTCCATCCAATGCGATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002213
VALIDATED
ITGB5 MISSION shRNA Lentiviral Transduction Particles
integrin, beta 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002213.3-493s21c1
Sequence:CCGGCTGAGGGCAAACCTTGTCAAACTCGAGTTTGACAAGGTTTGCCCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296117    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_002213.3-2970s21c1
Sequence:CCGGAGCTTGTTGTCCCAATGAAATCTCGAGATTTCATTGGGACAACAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_002213.3-1458s21c1
Sequence:CCGGGGATCAGCCTGAGGATCTTAACTCGAGTTAAGATCCTCAGGCTGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_002213.3-359s21c1
Sequence:CCGGGGCTCGCAGGTCTCAACATATCTCGAGATATGTTGAGACCTGCGAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002213.3-1225s21c1
Sequence:CCGGGCATCCAACCAGATGGACTATCTCGAGATAGTCCATCTGGTTGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002213.3-2588s1c1
Sequence:CCGGCCCGCTATGAAATGGCTTCAACTCGAGTTGAAGCCATTTCATAGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002213.3-1225s1c1
Sequence:CCGGGCATCCAACCAGATGGACTATCTCGAGATAGTCCATCTGGTTGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002213.3-2332s1c1
Sequence:CCGGGCTGTGCTATGTTTCTACAAACTCGAGTTTGTAGAAACATAGCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002213.3-1140s1c1
Sequence:CCGGCCACATCGCATTGGATGGAAACTCGAGTTTCCATCCAATGCGATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)