EMAIL THIS PAGE TO A FRIEND

ITGB6

integrin, beta 6

60 Gene Product Result for
UniProtKB ID: P18564, B2R9W5, Q0VA95, Q16500, Q53RG5, Q53RR6
Gene ID:
Mouse(16420) integrin beta 6
Rat(311061) integrin, beta 6
Zebrafish(100499533) integrin, beta 6
domestic cat(101094363) integrin, beta 6
Horse(100051266) integrin, beta 6
cow(282644) integrin, beta 6
chicken(424191) integrin, beta 6
dog(488368) integrin, beta 6
sheep(443209) integrin, beta 6
Domestic Rabbit(100338232) integrin, beta 6
naked mole-rat(101701540) integrin, beta 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021359 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021359 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021359 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000888 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000888 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000888 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU009241 MISSION® esiRNA esiRNA targeting human ITGB6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000888 Rosetta Predictions human pricing
NM_001004263 Rosetta Predictions rat pricing
NM_021359 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000888 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120413 predicted 1009
2 SASI_Hs02_00303437 predicted 2094
3 SASI_Hs01_00120414 predicted 2132
4 SASI_Hs01_00120415 predicted 737
5 SASI_Hs01_00120416 predicted 1611
6 SASI_Hs01_00120418 predicted 929
7 SASI_Hs01_00120419 predicted 871
8 SASI_Hs02_00303438 predicted 1290
9 SASI_Hs01_00120420 predicted 993
10 SASI_Hs02_00303439 predicted 904
11 SASI_Hs01_00120412 predicted 675
12 SASI_Hs01_00120417 predicted 1090
13 SASI_Hs01_00120421 predicted 691
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004263 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073306 predicted 273
2 SASI_Rn01_00073307 predicted 537
3 SASI_Rn01_00073308 predicted 1679
4 SASI_Rn01_00073310 predicted 2105
5 SASI_Rn01_00073311 predicted 2094
6 SASI_Rn01_00073312 predicted 967
7 SASI_Rn01_00073313 predicted 446
8 SASI_Rn02_00198283 predicted 1985
9 SASI_Rn01_00073314 predicted 756
10 SASI_Rn01_00073315 predicted 1072
11 SASI_Rn01_00073309 predicted 2175
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021359 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183876 predicted 1814
2 SASI_Mm01_00183877 predicted 1795
3 SASI_Mm01_00183879 predicted 407
4 SASI_Mm01_00183880 predicted 1580
5 SASI_Mm01_00183881 predicted 476
6 SASI_Mm01_00183882 predicted 679
7 SASI_Mm01_00183883 predicted 684
8 SASI_Mm01_00183884 predicted 1204
9 SASI_Mm01_00183885 predicted 1121
10 SASI_Mm02_00325949 predicted 1771
11 SASI_Mm01_00183878 predicted 2316
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021359
ITGB6 MISSION shRNA Bacterial Glycerol Stock
integrin, beta 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021359.2-2203s1c1
Sequence:CCGGCCTGCTCTCTACAAGGAGAAACTCGAGTTTCTCCTTGTAGAGAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021359.2-678s1c1
Sequence:CCGGGCCAAAGAGATGTCCAAACTACTCGAGTAGTTTGGACATCTCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021359.2-858s1c1
Sequence:CCGGGCCGAGAGATTCAATGAAATTCTCGAGAATTTCATTGAATCTCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021359.2-439s1c1
Sequence:CCGGCCCGCATAGAAGTCCTTCAAACTCGAGTTTGAAGGACTTCTATGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021359.2-3483s1c1
Sequence:CCGGCCCTCCTATTATTCCACATTTCTCGAGAAATGTGGAATAATAGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021359.3-1164s21c1
Sequence:CCGGTATCGGCCAACTCATTGATAACTCGAGTTATCAATGAGTTGGCCGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021359.3-2273s21c1
Sequence:CCGGTCCTAATAACTACGGATAATGCTCGAGCATTATCCGTAGTTATTAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021359.3-920s21c1
Sequence:CCGGAGAAGATTTCTGCTAATATTGCTCGAGCAATATTAGCAGAAATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021359.3-889s21c1
Sequence:CCGGGCCGAGAGATTCAATGAAATTCTCGAGAATTTCATTGAATCTCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021359.3-3514s21c1
Sequence:CCGGCCCTCCTATTATTCCACATTTCTCGAGAAATGTGGAATAATAGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021359
ITGB6 MISSION shRNA shRNA Plasmid DNA
integrin, beta 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021359.2-2203s1c1
Sequence:CCGGCCTGCTCTCTACAAGGAGAAACTCGAGTTTCTCCTTGTAGAGAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021359.2-678s1c1
Sequence:CCGGGCCAAAGAGATGTCCAAACTACTCGAGTAGTTTGGACATCTCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021359.2-858s1c1
Sequence:CCGGGCCGAGAGATTCAATGAAATTCTCGAGAATTTCATTGAATCTCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021359.2-439s1c1
Sequence:CCGGCCCGCATAGAAGTCCTTCAAACTCGAGTTTGAAGGACTTCTATGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021359.2-3483s1c1
Sequence:CCGGCCCTCCTATTATTCCACATTTCTCGAGAAATGTGGAATAATAGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021359.3-1164s21c1
Sequence:CCGGTATCGGCCAACTCATTGATAACTCGAGTTATCAATGAGTTGGCCGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021359.3-2273s21c1
Sequence:CCGGTCCTAATAACTACGGATAATGCTCGAGCATTATCCGTAGTTATTAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021359.3-920s21c1
Sequence:CCGGAGAAGATTTCTGCTAATATTGCTCGAGCAATATTAGCAGAAATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021359.3-889s21c1
Sequence:CCGGGCCGAGAGATTCAATGAAATTCTCGAGAATTTCATTGAATCTCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021359.3-3514s21c1
Sequence:CCGGCCCTCCTATTATTCCACATTTCTCGAGAAATGTGGAATAATAGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021359
ITGB6 MISSION shRNA Lentiviral Transduction Particles
integrin, beta 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021359.2-2203s1c1
Sequence:CCGGCCTGCTCTCTACAAGGAGAAACTCGAGTTTCTCCTTGTAGAGAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021359.2-678s1c1
Sequence:CCGGGCCAAAGAGATGTCCAAACTACTCGAGTAGTTTGGACATCTCTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021359.2-858s1c1
Sequence:CCGGGCCGAGAGATTCAATGAAATTCTCGAGAATTTCATTGAATCTCTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021359.2-439s1c1
Sequence:CCGGCCCGCATAGAAGTCCTTCAAACTCGAGTTTGAAGGACTTCTATGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021359.2-3483s1c1
Sequence:CCGGCCCTCCTATTATTCCACATTTCTCGAGAAATGTGGAATAATAGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021359.3-1164s21c1
Sequence:CCGGTATCGGCCAACTCATTGATAACTCGAGTTATCAATGAGTTGGCCGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021359.3-2273s21c1
Sequence:CCGGTCCTAATAACTACGGATAATGCTCGAGCATTATCCGTAGTTATTAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021359.3-920s21c1
Sequence:CCGGAGAAGATTTCTGCTAATATTGCTCGAGCAATATTAGCAGAAATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021359.3-889s21c1
Sequence:CCGGGCCGAGAGATTCAATGAAATTCTCGAGAATTTCATTGAATCTCTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021359.3-3514s21c1
Sequence:CCGGCCCTCCTATTATTCCACATTTCTCGAGAAATGTGGAATAATAGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000888
ITGB6 MISSION shRNA Bacterial Glycerol Stock
integrin, beta 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000888.3-659s1c1
Sequence:CCGGCCATTGACAAATGATGCTGAACTCGAGTTCAGCATCATTTGTCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000888.3-1939s1c1
Sequence:CCGGCCGAGAAGAATGTGTGGACAACTCGAGTTGTCCACACATTCTTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000888.3-596s1c1
Sequence:CCGGGCCAACCCTTGCAGTAGTATTCTCGAGAATACTACTGCAAGGGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000888.3-1605s1c1
Sequence:CCGGGAAACATTTATGGGCCTTATTCTCGAGAATAAGGCCCATAAATGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000888.3-2216s21c1
Sequence:CCGGGTGTCATTTCATGATCGTAAACTCGAGTTTACGATCATGAAATGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000888.3-454s21c1
Sequence:CCGGTGACGACCTCAACACAATAAACTCGAGTTTATTGTGTTGAGGTCGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000888.3-620s21c1
Sequence:CCGGTACTTCTGTTTACCTACATTTCTCGAGAAATGTAGGTAAACAGAAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000888.3-945s21c1
Sequence:CCGGCAACAATTGGACAACTCATTGCTCGAGCAATGAGTTGTCCAATTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000888
ITGB6 MISSION shRNA shRNA Plasmid DNA
integrin, beta 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000888.3-659s1c1
Sequence:CCGGCCATTGACAAATGATGCTGAACTCGAGTTCAGCATCATTTGTCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000888.3-1939s1c1
Sequence:CCGGCCGAGAAGAATGTGTGGACAACTCGAGTTGTCCACACATTCTTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000888.3-596s1c1
Sequence:CCGGGCCAACCCTTGCAGTAGTATTCTCGAGAATACTACTGCAAGGGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000888.3-1605s1c1
Sequence:CCGGGAAACATTTATGGGCCTTATTCTCGAGAATAAGGCCCATAAATGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000888.3-2216s21c1
Sequence:CCGGGTGTCATTTCATGATCGTAAACTCGAGTTTACGATCATGAAATGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000888.3-454s21c1
Sequence:CCGGTGACGACCTCAACACAATAAACTCGAGTTTATTGTGTTGAGGTCGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000888.3-620s21c1
Sequence:CCGGTACTTCTGTTTACCTACATTTCTCGAGAAATGTAGGTAAACAGAAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000888.3-945s21c1
Sequence:CCGGCAACAATTGGACAACTCATTGCTCGAGCAATGAGTTGTCCAATTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000888
ITGB6 MISSION shRNA Lentiviral Transduction Particles
integrin, beta 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000888.3-659s1c1
Sequence:CCGGCCATTGACAAATGATGCTGAACTCGAGTTCAGCATCATTTGTCAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000888.3-1939s1c1
Sequence:CCGGCCGAGAAGAATGTGTGGACAACTCGAGTTGTCCACACATTCTTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000888.3-596s1c1
Sequence:CCGGGCCAACCCTTGCAGTAGTATTCTCGAGAATACTACTGCAAGGGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000888.3-1605s1c1
Sequence:CCGGGAAACATTTATGGGCCTTATTCTCGAGAATAAGGCCCATAAATGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000888.3-2216s21c1
Sequence:CCGGGTGTCATTTCATGATCGTAAACTCGAGTTTACGATCATGAAATGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000888.3-454s21c1
Sequence:CCGGTGACGACCTCAACACAATAAACTCGAGTTTATTGTGTTGAGGTCGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000888.3-620s21c1
Sequence:CCGGTACTTCTGTTTACCTACATTTCTCGAGAAATGTAGGTAAACAGAAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000888.3-945s21c1
Sequence:CCGGCAACAATTGGACAACTCATTGCTCGAGCAATGAGTTGTCCAATTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)