EMAIL THIS PAGE TO A FRIEND

ITGB7

integrin, beta 7

68 Gene Product Result for
UniProtKB ID: P26010, Q9UCP7, Q9UCS7
Gene ID:
Mouse(16421) integrin beta 7
Rat(25713) integrin, beta 7
naked mole-rat(101719620) integrin, beta 7
sheep(101109956) integrin, beta 7
Domestic Rabbit(100350557) integrin, beta 7
dog(477598) integrin, beta 7
Horse(100063747) integrin, beta 7
cow(514031) integrin, beta 7
domestic cat(101099982) integrin, beta 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000889 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000889 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000889 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013566 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013566 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013566 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000889 Rosetta Predictions human pricing
XM_001067562 Rosetta Predictions rat pricing
XM_343336 Rosetta Predictions rat pricing
NM_013566 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000889 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140217 predicted 1003
2 SASI_Hs01_00140219 predicted 1286
3 SASI_Hs01_00140220 predicted 1892
4 SASI_Hs01_00140222 predicted 2502
5 SASI_Hs01_00140223 predicted 2496
6 SASI_Hs01_00140224 predicted 2464
7 SASI_Hs01_00140225 predicted 702
8 SASI_Hs01_00140226 predicted 1285
9 SASI_Hs02_00303440 predicted 1545
10 SASI_Hs02_00303441 predicted 2328
11 SASI_Hs01_00140218 predicted 2465
12 SASI_Hs01_00140221 predicted 1447
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067562 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00321402 predicted 1304
2 SASI_Rn02_00321403 predicted 1279
3 SASI_Rn02_00321404 predicted 1011
4 SASI_Rn02_00321405 predicted 1292
5 SASI_Rn02_00321406 predicted 846
6 SASI_Rn02_00321407 predicted 472
7 SASI_Rn02_00321408 predicted 949
8 SASI_Rn02_00321409 predicted 1524
9 SASI_Rn02_00321410 predicted 461
10 SASI_Rn02_00321411 predicted 550
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343336 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395653 predicted 470
2 SASI_Rn02_00395654 predicted 449
3 SASI_Rn02_00395655 predicted 433
4 SASI_Rn02_00395656 predicted 481
5 SASI_Rn02_00395657 predicted 472
6 SASI_Rn02_00395658 predicted 231
7 SASI_Rn02_00395659 predicted 462
8 SASI_Rn02_00395660 predicted 436
9 SASI_Rn02_00395661 predicted 228
10 SASI_Rn02_00395662 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013566 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114653 predicted 2398
2 SASI_Mm01_00114654 predicted 635
3 SASI_Mm01_00114655 predicted 1105
4 SASI_Mm01_00114656 predicted 1834
5 SASI_Mm01_00114657 predicted 2396
6 SASI_Mm01_00114658 predicted 640
7 SASI_Mm01_00114659 predicted 282
8 SASI_Mm01_00114661 predicted 2018
9 SASI_Mm01_00114662 predicted 1375
10 SASI_Mm02_00322306 predicted 1097
11 SASI_Mm01_00114660 predicted 894
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000889
ITGB7 MISSION shRNA Bacterial Glycerol Stock
integrin, beta 7
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000057718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000889.1-1116s1c1
Sequence:CCGGGCACAGAGTTTGACTACCCTTCTCGAGAAGGGTAGTCAAACTCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000889.1-2501s1c1
Sequence:CCGGACCACCATCAATCCTCGCTTTCTCGAGAAAGCGAGGATTGATGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000889.1-1225s1c1
Sequence:CCGGGCTGAGTAAACTGATTCCTAACTCGAGTTAGGAATCAGTTTACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000889.1-2034s1c1
Sequence:CCGGACGGCTACTATGGTGCTCTATCTCGAGATAGAGCACCATAGTAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000889
ITGB7 MISSION shRNA shRNA Plasmid DNA
integrin, beta 7
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000057718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000889.1-1116s1c1
Sequence:CCGGGCACAGAGTTTGACTACCCTTCTCGAGAAGGGTAGTCAAACTCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000889.1-2501s1c1
Sequence:CCGGACCACCATCAATCCTCGCTTTCTCGAGAAAGCGAGGATTGATGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000889.1-1225s1c1
Sequence:CCGGGCTGAGTAAACTGATTCCTAACTCGAGTTAGGAATCAGTTTACTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000889.1-2034s1c1
Sequence:CCGGACGGCTACTATGGTGCTCTATCTCGAGATAGAGCACCATAGTAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000889
ITGB7 MISSION shRNA Lentiviral Transduction Particles
integrin, beta 7
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000057718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000889.1-1116s1c1
Sequence:CCGGGCACAGAGTTTGACTACCCTTCTCGAGAAGGGTAGTCAAACTCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000889.1-2501s1c1
Sequence:CCGGACCACCATCAATCCTCGCTTTCTCGAGAAAGCGAGGATTGATGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000889.1-1225s1c1
Sequence:CCGGGCTGAGTAAACTGATTCCTAACTCGAGTTAGGAATCAGTTTACTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000889.1-2034s1c1
Sequence:CCGGACGGCTACTATGGTGCTCTATCTCGAGATAGAGCACCATAGTAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013566
ITGB7 MISSION shRNA Bacterial Glycerol Stock
integrin, beta 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013566.1-1173s1c1
Sequence:CCGGGCAGCTCATCATGGATGCTTACTCGAGTAAGCATCCATGATGAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013566.1-1881s1c1
Sequence:CCGGGCACGGATACTGCAAATGCAACTCGAGTTGCATTTGCAGTATCCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013566.1-489s1c1
Sequence:CCGGCGTGGACCTATATTACCTTATCTCGAGATAAGGTAATATAGGTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013566.1-878s1c1
Sequence:CCGGCCCGTCTTCTAGTGTTCACTTCTCGAGAAGTGAACACTAGAAGACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013566.1-2346s1c1
Sequence:CCGGGCAGGACAACAATCCTCTCTACTCGAGTAGAGAGGATTGTTGTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013566
ITGB7 MISSION shRNA shRNA Plasmid DNA
integrin, beta 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013566.1-1173s1c1
Sequence:CCGGGCAGCTCATCATGGATGCTTACTCGAGTAAGCATCCATGATGAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013566.1-1881s1c1
Sequence:CCGGGCACGGATACTGCAAATGCAACTCGAGTTGCATTTGCAGTATCCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013566.1-489s1c1
Sequence:CCGGCGTGGACCTATATTACCTTATCTCGAGATAAGGTAATATAGGTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013566.1-878s1c1
Sequence:CCGGCCCGTCTTCTAGTGTTCACTTCTCGAGAAGTGAACACTAGAAGACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013566.1-2346s1c1
Sequence:CCGGGCAGGACAACAATCCTCTCTACTCGAGTAGAGAGGATTGTTGTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013566
ITGB7 MISSION shRNA Lentiviral Transduction Particles
integrin, beta 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013566.1-1173s1c1
Sequence:CCGGGCAGCTCATCATGGATGCTTACTCGAGTAAGCATCCATGATGAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013566.1-1881s1c1
Sequence:CCGGGCACGGATACTGCAAATGCAACTCGAGTTGCATTTGCAGTATCCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013566.1-489s1c1
Sequence:CCGGCGTGGACCTATATTACCTTATCTCGAGATAAGGTAATATAGGTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013566.1-878s1c1
Sequence:CCGGCCCGTCTTCTAGTGTTCACTTCTCGAGAAGTGAACACTAGAAGACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013566.1-2346s1c1
Sequence:CCGGGCAGGACAACAATCCTCTCTACTCGAGTAGAGAGGATTGTTGTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)