EMAIL THIS PAGE TO A FRIEND

ITGB8

integrin, beta 8

323 Gene Product Result for
UniProtKB ID: P26012, A4D133
Gene ID:
Human(3696) Summary: This gene is a member of the integrin beta chain family and encodes a single-pass type I membrane protein with a VWFA domain and four cysteine-rich repeats. This protein noncovalently binds to an alpha subunit to form a heterodimeric integrin complex. In general, integrin complexes mediate cell-cell and cell-extracellular matrix interactions and this complex plays a role in human airway epithelial proliferation. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
Mouse(320910) integrin beta 8
Rat(362800) integrin, beta 8
Zebrafish(556752) integrin, beta 8
cow(536286) integrin, beta 8
Horse(100053462) integrin, beta 8
domestic cat(101087724) integrin, beta 8
dog(475253) integrin, beta 8
chicken(395470) integrin, beta 8
sheep(101107517) integrin, beta 8
Domestic Rabbit(100009141) integrin, beta 8
naked mole-rat(101703316) integrin, beta 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_484197 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_484197 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_484197 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002214 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002214 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002214 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002214 Rosetta Predictions human pricing
NM_001108726 Rosetta Predictions rat pricing
NM_177290 Rosetta Predictions mouse pricing
XM_484197 Rosetta Predictions mouse pricing
XM_901353 Rosetta Predictions mouse pricing
XM_901358 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002214 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121941 predicted 2715
2 SASI_Hs01_00121942 predicted 952
3 SASI_Hs01_00121944 predicted 1635
4 SASI_Hs01_00121945 predicted 2128
5 SASI_Hs01_00121946 predicted 1209
6 SASI_Hs01_00121947 predicted 1972
7 SASI_Hs01_00121948 predicted 1839
8 SASI_Hs02_00333440 predicted 2807
9 SASI_Hs01_00121949 predicted 2657
10 SASI_Hs01_00121950 predicted 2272
11 SASI_Hs01_00121943 predicted 1137
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108726 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241475 predicted 1658
2 SASI_Rn02_00241476 predicted 2070
3 SASI_Rn02_00241477 predicted 1695
4 SASI_Rn02_00241478 predicted 1143
5 SASI_Rn02_00241479 predicted 1690
6 SASI_Rn02_00241480 predicted 1911
7 SASI_Rn02_00241481 predicted 1556
8 SASI_Rn02_00241482 predicted 2207
9 SASI_Rn02_00241483 predicted 1318
10 SASI_Rn02_00241484 predicted 1195
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177290 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347358 predicted 2250
2 SASI_Mm02_00347359 predicted 914
3 SASI_Mm02_00347360 predicted 1347
4 SASI_Mm02_00347361 predicted 1022
5 SASI_Mm02_00347362 predicted 2588
6 SASI_Mm02_00347363 predicted 1736
7 SASI_Mm02_00347364 predicted 1095
8 SASI_Mm02_00347365 predicted 1425
9 SASI_Mm02_00347366 predicted 2433
10 SASI_Mm02_00347367 predicted 2581
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_484197 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00213624 predicted 2656
2 SASI_Mm01_00213625 predicted 1330
3 SASI_Mm01_00213626 predicted 1767
4 SASI_Mm01_00213627 predicted 1426
5 SASI_Mm01_00213628 predicted 3002
6 SASI_Mm01_00213629 predicted 1512
7 SASI_Mm01_00213630 predicted 2887
8 SASI_Mm01_00213631 predicted 1839
9 SASI_Mm01_00213632 predicted 2843
10 SASI_Mm01_00213633 predicted 2997
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901353 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00249143 predicted 1106
2 SASI_Mm01_00249144 predicted 1536
3 SASI_Mm01_00249145 predicted 1513
4 SASI_Mm01_00249146 predicted 1428
5 SASI_Mm01_00249147 predicted 1490
6 SASI_Mm01_00249148 predicted 1525
7 SASI_Mm01_00249149 predicted 1252
8 SASI_Mm01_00249150 predicted 1418
9 SASI_Mm01_00249151 predicted 1567
10 SASI_Mm01_00249152 predicted 1379
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901358 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00217583 predicted 1137
2 SASI_Mm01_00217584 predicted 1446
3 SASI_Mm01_00217585 predicted 1886
4 SASI_Mm01_00217586 predicted 1547
5 SASI_Mm01_00217587 predicted 1285
6 SASI_Mm01_00217588 predicted 1620
7 SASI_Mm01_00217589 predicted 1984
8 SASI_Mm01_00217590 predicted 1806
9 SASI_Mm01_00217591 predicted 1645
10 SASI_Mm01_00217592 predicted 1860
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_484197
ITGB8 MISSION shRNA Bacterial Glycerol Stock
integrin, beta 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484197.1-3431s1c1
Sequence:CCGGGCAAGTGTCTTCACAACCATACTCGAGTATGGTTGTGAAGACACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484197.1-3086s1c1
Sequence:CCGGCGGGTTGCTTAAAGTTCTTATCTCGAGATAAGAACTTTAAGCAACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484197.1-3034s1c1
Sequence:CCGGGCCCAAGCTATCTGCGAATATCTCGAGATATTCGCAGATAGCTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484197.1-1123s1c1
Sequence:CCGGGCCAAAGTGAACACAATAGATCTCGAGATCTATTGTGTTCACTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484197.1-2112s1c1
Sequence:CCGGGCTGCAAATCTCAACAATTTACTCGAGTAAATTGTTGAGATTTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_484197
ITGB8 MISSION shRNA shRNA Plasmid DNA
integrin, beta 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484197.1-3431s1c1
Sequence:CCGGGCAAGTGTCTTCACAACCATACTCGAGTATGGTTGTGAAGACACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484197.1-3086s1c1
Sequence:CCGGCGGGTTGCTTAAAGTTCTTATCTCGAGATAAGAACTTTAAGCAACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484197.1-3034s1c1
Sequence:CCGGGCCCAAGCTATCTGCGAATATCTCGAGATATTCGCAGATAGCTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484197.1-1123s1c1
Sequence:CCGGGCCAAAGTGAACACAATAGATCTCGAGATCTATTGTGTTCACTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484197.1-2112s1c1
Sequence:CCGGGCTGCAAATCTCAACAATTTACTCGAGTAAATTGTTGAGATTTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_484197
ITGB8 MISSION shRNA Lentiviral Transduction Particles
integrin, beta 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484197.1-3431s1c1
Sequence:CCGGGCAAGTGTCTTCACAACCATACTCGAGTATGGTTGTGAAGACACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484197.1-3086s1c1
Sequence:CCGGCGGGTTGCTTAAAGTTCTTATCTCGAGATAAGAACTTTAAGCAACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484197.1-3034s1c1
Sequence:CCGGGCCCAAGCTATCTGCGAATATCTCGAGATATTCGCAGATAGCTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484197.1-1123s1c1
Sequence:CCGGGCCAAAGTGAACACAATAGATCTCGAGATCTATTGTGTTCACTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484197.1-2112s1c1
Sequence:CCGGGCTGCAAATCTCAACAATTTACTCGAGTAAATTGTTGAGATTTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002214
ITGB8 MISSION shRNA Bacterial Glycerol Stock
integrin, beta 8
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002214.1-2690s1c1
Sequence:CCGGCGACCAAACTTCAGAATGTTTCTCGAGAAACATTCTGAAGTTTGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002214.1-1948s1c1
Sequence:CCGGCGAGCAATGATGAAGTTCTTTCTCGAGAAAGAACTTCATCATTGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002214.1-961s1c1
Sequence:CCGGGCTCAGTTGATTCAATAGAATCTCGAGATTCTATTGAATCAACTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002214.1-1223s1c1
Sequence:CCGGCCGTGACTTTCGTCTTGGATTCTCGAGAATCCAAGACGAAAGTCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002214.1-2449s1c1
Sequence:CCGGCCCAGCACTGTGTCAATTCAACTCGAGTTGAATTGACACAGTGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002214.2-2262s21c1
Sequence:CCGGTTGCAGTGGTCGAGGAGTTTGCTCGAGCAAACTCCTCGACCACTGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002214.2-1205s21c1
Sequence:CCGGATTCCGTTGGAAACGATTTATCTCGAGATAAATCGTTTCCAACGGAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002214.2-2798s21c1
Sequence:CCGGTGCTTAAAGTCCTGATCATTACTCGAGTAATGATCAGGACTTTAAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002214.2-1333s21c1
Sequence:CCGGCAATGCAGTGACTACAATTTACTCGAGTAAATTGTAGTCACTGCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002214.2-1171s21c1
Sequence:CCGGTCAGCATCAATGCACAATAATCTCGAGATTATTGTGCATTGATGCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002214
ITGB8 MISSION shRNA shRNA Plasmid DNA
integrin, beta 8
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002214.1-2690s1c1
Sequence:CCGGCGACCAAACTTCAGAATGTTTCTCGAGAAACATTCTGAAGTTTGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002214.1-1948s1c1
Sequence:CCGGCGAGCAATGATGAAGTTCTTTCTCGAGAAAGAACTTCATCATTGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002214.1-961s1c1
Sequence:CCGGGCTCAGTTGATTCAATAGAATCTCGAGATTCTATTGAATCAACTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002214.1-1223s1c1
Sequence:CCGGCCGTGACTTTCGTCTTGGATTCTCGAGAATCCAAGACGAAAGTCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002214.1-2449s1c1
Sequence:CCGGCCCAGCACTGTGTCAATTCAACTCGAGTTGAATTGACACAGTGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002214.2-2262s21c1
Sequence:CCGGTTGCAGTGGTCGAGGAGTTTGCTCGAGCAAACTCCTCGACCACTGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002214.2-1205s21c1
Sequence:CCGGATTCCGTTGGAAACGATTTATCTCGAGATAAATCGTTTCCAACGGAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002214.2-2798s21c1
Sequence:CCGGTGCTTAAAGTCCTGATCATTACTCGAGTAATGATCAGGACTTTAAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002214.2-1333s21c1
Sequence:CCGGCAATGCAGTGACTACAATTTACTCGAGTAAATTGTAGTCACTGCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002214.2-1171s21c1
Sequence:CCGGTCAGCATCAATGCACAATAATCTCGAGATTATTGTGCATTGATGCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002214
ITGB8 MISSION shRNA Lentiviral Transduction Particles
integrin, beta 8
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002214.1-2690s1c1
Sequence:CCGGCGACCAAACTTCAGAATGTTTCTCGAGAAACATTCTGAAGTTTGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002214.1-1948s1c1
Sequence:CCGGCGAGCAATGATGAAGTTCTTTCTCGAGAAAGAACTTCATCATTGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002214.1-961s1c1
Sequence:CCGGGCTCAGTTGATTCAATAGAATCTCGAGATTCTATTGAATCAACTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002214.1-1223s1c1
Sequence:CCGGCCGTGACTTTCGTCTTGGATTCTCGAGAATCCAAGACGAAAGTCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002214.1-2449s1c1
Sequence:CCGGCCCAGCACTGTGTCAATTCAACTCGAGTTGAATTGACACAGTGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002214.2-2262s21c1
Sequence:CCGGTTGCAGTGGTCGAGGAGTTTGCTCGAGCAAACTCCTCGACCACTGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002214.2-1205s21c1
Sequence:CCGGATTCCGTTGGAAACGATTTATCTCGAGATAAATCGTTTCCAACGGAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002214.2-2798s21c1
Sequence:CCGGTGCTTAAAGTCCTGATCATTACTCGAGTAATGATCAGGACTTTAAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002214.2-1333s21c1
Sequence:CCGGCAATGCAGTGACTACAATTTACTCGAGTAAATTGTAGTCACTGCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002214.2-1171s21c1
Sequence:CCGGTCAGCATCAATGCACAATAATCTCGAGATTATTGTGCATTGATGCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)