EMAIL THIS PAGE TO A FRIEND

ITIH1

inter-alpha-trypsin inhibitor heavy chain 1

55 Gene Product Result for
Synonyms: H1P IATIH IGHEP1 ITI-HC1 ITIH SHAP
Gene ID:
Human(3697) Summary: The protein encoded by this gene is the heavy chain of a serine protease inhibitor that may serve to carry hyaluronan in plasma. This gene is part of a cluster of similar genes on chromosome 3. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Mouse(16424) inter-alpha trypsin inhibitor, heavy chain 1
Rat(306251) inter-alpha trypsin inhibitor, heavy chain 1
sheep(101109489) inter-alpha-trypsin inhibitor heavy chain 1
Domestic Rabbit(100009344) inter-alpha-trypsin inhibitor heavy chain 1
domestic guinea pig(100727363) inter-alpha-trypsin inhibitor heavy chain 1
naked mole-rat(101724277) inter-alpha-trypsin inhibitor heavy chain 1
dog(476590) inter-alpha-trypsin inhibitor heavy chain 1
cow(508356) inter-alpha-trypsin inhibitor heavy chain 1
domestic cat(101086459) inter-alpha-trypsin inhibitor heavy chain 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0517 AQUA Peptide TIHLTVNPQS[K] human pricing
AQ0518 AQUA Peptide LDAQASFLP[K] human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008406 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008406 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008406 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002215 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002215 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002215 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002215 Rosetta Predictions human pricing
NM_001107291 Rosetta Predictions rat pricing
NM_008406 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002215 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124976 predicted 2283
2 SASI_Hs01_00124977 predicted 2236
3 SASI_Hs01_00124978 predicted 1201
4 SASI_Hs01_00124979 predicted 1327
5 SASI_Hs01_00124980 predicted 1526
6 SASI_Hs01_00124981 predicted 495
7 SASI_Hs01_00124982 predicted 2201
8 SASI_Hs01_00124983 predicted 2102
9 SASI_Hs01_00124984 predicted 1144
10 SASI_Hs01_00124985 predicted 764
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107291 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227395 predicted 219
2 SASI_Rn02_00227396 predicted 769
3 SASI_Rn02_00227397 predicted 298
4 SASI_Rn02_00227398 predicted 641
5 SASI_Rn02_00227399 predicted 305
6 SASI_Rn02_00227400 predicted 604
7 SASI_Rn02_00227401 predicted 290
8 SASI_Rn02_00227402 predicted 341
9 SASI_Rn02_00227403 predicted 878
10 SASI_Rn02_00227404 predicted 329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008406 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313849 predicted 2697
2 SASI_Mm01_00083496 predicted 443
3 SASI_Mm01_00083497 predicted 1189
4 SASI_Mm01_00083498 predicted 1793
5 SASI_Mm01_00083499 predicted 313
6 SASI_Mm01_00083500 predicted 581
7 SASI_Mm01_00083501 predicted 831
8 SASI_Mm02_00313850 predicted 2686
9 SASI_Mm01_00083502 predicted 941
10 SASI_Mm01_00083503 predicted 1569
11 SASI_Mm01_00083504 predicted 2035
12 SASI_Mm01_00083505 predicted 326
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008406
ITIH1 MISSION shRNA Bacterial Glycerol Stock
inter-alpha-trypsin inhibitor heavy chain 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008406.1-2733s1c1
Sequence:CCGGCCAGCTAACACAGCAGCCTTTCTCGAGAAAGGCTGCTGTGTTAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008406.1-812s1c1
Sequence:CCGGCCAACAACTACTTTACACATTCTCGAGAATGTGTAAAGTAGTTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008406.1-2169s1c1
Sequence:CCGGGAGCACATACTTCGGGAGATTCTCGAGAATCTCCCGAAGTATGTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008406.1-145s1c1
Sequence:CCGGGTGTCCATCAAGAGCTTGAAACTCGAGTTTCAAGCTCTTGATGGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008406.1-811s1c1
Sequence:CCGGGCCAACAACTACTTTACACATCTCGAGATGTGTAAAGTAGTTGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008406
ITIH1 MISSION shRNA shRNA Plasmid DNA
inter-alpha-trypsin inhibitor heavy chain 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008406.1-2733s1c1
Sequence:CCGGCCAGCTAACACAGCAGCCTTTCTCGAGAAAGGCTGCTGTGTTAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008406.1-812s1c1
Sequence:CCGGCCAACAACTACTTTACACATTCTCGAGAATGTGTAAAGTAGTTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008406.1-2169s1c1
Sequence:CCGGGAGCACATACTTCGGGAGATTCTCGAGAATCTCCCGAAGTATGTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008406.1-145s1c1
Sequence:CCGGGTGTCCATCAAGAGCTTGAAACTCGAGTTTCAAGCTCTTGATGGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008406.1-811s1c1
Sequence:CCGGGCCAACAACTACTTTACACATCTCGAGATGTGTAAAGTAGTTGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008406
ITIH1 MISSION shRNA Lentiviral Transduction Particles
inter-alpha-trypsin inhibitor heavy chain 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008406.1-2733s1c1
Sequence:CCGGCCAGCTAACACAGCAGCCTTTCTCGAGAAAGGCTGCTGTGTTAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008406.1-812s1c1
Sequence:CCGGCCAACAACTACTTTACACATTCTCGAGAATGTGTAAAGTAGTTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008406.1-2169s1c1
Sequence:CCGGGAGCACATACTTCGGGAGATTCTCGAGAATCTCCCGAAGTATGTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008406.1-145s1c1
Sequence:CCGGGTGTCCATCAAGAGCTTGAAACTCGAGTTTCAAGCTCTTGATGGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008406.1-811s1c1
Sequence:CCGGGCCAACAACTACTTTACACATCTCGAGATGTGTAAAGTAGTTGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002215
ITIH1 MISSION shRNA Bacterial Glycerol Stock
inter-alpha-trypsin inhibitor heavy chain 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002215.1-543s1c1
Sequence:CCGGGCAGTATGAAATTGTCATCAACTCGAGTTGATGACAATTTCATACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002215.1-2399s1c1
Sequence:CCGGGTGGCACCTTTGAGGTTGTTTCTCGAGAAACAACCTCAAAGGTGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002215.1-879s1c1
Sequence:CCGGCCTGACAAACATGAACAAGAACTCGAGTTCTTGTTCATGTTTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002215.1-345s1c1
Sequence:CCGGCGCATTTATCGGAGACATAAACTCGAGTTTATGTCTCCGATAAATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002215.1-1203s1c1
Sequence:CCGGCCATGCCTCAATACTCATCATCTCGAGATGATGAGTATTGAGGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002215.2-1562s21c1
Sequence:CCGGGGCGCATTGCTGACAACAAACCTCGAGGTTTGTTGTCAGCAATGCGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002215.2-1328s21c1
Sequence:CCGGTCGGCCACAATGTGGACTTTACTCGAGTAAAGTCCACATTGTGGCCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002215.2-497s21c1
Sequence:CCGGTCACGTTTCAGCTGACTTATGCTCGAGCATAAGTCAGCTGAAACGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002215
ITIH1 MISSION shRNA shRNA Plasmid DNA
inter-alpha-trypsin inhibitor heavy chain 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002215.1-543s1c1
Sequence:CCGGGCAGTATGAAATTGTCATCAACTCGAGTTGATGACAATTTCATACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002215.1-2399s1c1
Sequence:CCGGGTGGCACCTTTGAGGTTGTTTCTCGAGAAACAACCTCAAAGGTGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002215.1-879s1c1
Sequence:CCGGCCTGACAAACATGAACAAGAACTCGAGTTCTTGTTCATGTTTGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002215.1-345s1c1
Sequence:CCGGCGCATTTATCGGAGACATAAACTCGAGTTTATGTCTCCGATAAATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002215.1-1203s1c1
Sequence:CCGGCCATGCCTCAATACTCATCATCTCGAGATGATGAGTATTGAGGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002215.2-1562s21c1
Sequence:CCGGGGCGCATTGCTGACAACAAACCTCGAGGTTTGTTGTCAGCAATGCGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002215.2-1328s21c1
Sequence:CCGGTCGGCCACAATGTGGACTTTACTCGAGTAAAGTCCACATTGTGGCCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002215.2-497s21c1
Sequence:CCGGTCACGTTTCAGCTGACTTATGCTCGAGCATAAGTCAGCTGAAACGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002215
ITIH1 MISSION shRNA Lentiviral Transduction Particles
inter-alpha-trypsin inhibitor heavy chain 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002215.1-543s1c1
Sequence:CCGGGCAGTATGAAATTGTCATCAACTCGAGTTGATGACAATTTCATACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002215.1-2399s1c1
Sequence:CCGGGTGGCACCTTTGAGGTTGTTTCTCGAGAAACAACCTCAAAGGTGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002215.1-879s1c1
Sequence:CCGGCCTGACAAACATGAACAAGAACTCGAGTTCTTGTTCATGTTTGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002215.1-345s1c1
Sequence:CCGGCGCATTTATCGGAGACATAAACTCGAGTTTATGTCTCCGATAAATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002215.1-1203s1c1
Sequence:CCGGCCATGCCTCAATACTCATCATCTCGAGATGATGAGTATTGAGGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002215.2-1562s21c1
Sequence:CCGGGGCGCATTGCTGACAACAAACCTCGAGGTTTGTTGTCAGCAATGCGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002215.2-1328s21c1
Sequence:CCGGTCGGCCACAATGTGGACTTTACTCGAGTAAAGTCCACATTGTGGCCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002215.2-497s21c1
Sequence:CCGGTCACGTTTCAGCTGACTTATGCTCGAGCATAAGTCAGCTGAAACGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)