EMAIL THIS PAGE TO A FRIEND

ITIH2

inter-alpha-trypsin inhibitor heavy chain 2

70 Gene Product Result for
Synonyms: H2P SHAP
UniProtKB ID: P19823, Q14659, Q15484, Q5T986
Gene ID:
Human(3698) Summary: The inter-alpha-trypsin inhibitors (ITI) are a family of structurally related plasma serine protease inhibitors involved in extracellular matrix stabilization and in prevention of tumor metastasis. The ITI family contains multiple proteins made up of a light chain (see MIM 176870) and a variable number of heavy chains (Salier et al., 1987 [PubMed 2446322]
Mouse(16425) inter-alpha trypsin inhibitor, heavy chain 2
Rat(498793) inter-alpha-trypsin inhibitor heavy chain 2
Zebrafish(406280) inter-alpha (globulin) inhibitor H2
cow(512164) inter-alpha-trypsin inhibitor heavy chain 2
Horse(100070004) inter-alpha-trypsin inhibitor heavy chain 2
domestic cat(101101320) inter-alpha-trypsin inhibitor heavy chain 2
dog(478011) inter-alpha-trypsin inhibitor heavy chain 2
chicken(419110) inter-alpha-trypsin inhibitor heavy chain 2
domestic guinea pig(100713209) inter-alpha-trypsin inhibitor heavy chain 2
naked mole-rat(101725940) inter-alpha-trypsin inhibitor heavy chain 2
sheep(101114796) inter-alpha-trypsin inhibitor heavy chain 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002216 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002216 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002216 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010582 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010582 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010582 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002216 Rosetta Predictions human pricing
XM_574079 Rosetta Predictions rat pricing
XR_005459 Rosetta Predictions rat pricing
XR_009617 Rosetta Predictions rat pricing
NM_010582 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002216 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032729 predicted 1198
2 SASI_Hs01_00032731 predicted 1649
3 SASI_Hs01_00032732 predicted 1063
4 SASI_Hs02_00333441 predicted 1225
5 SASI_Hs01_00032733 predicted 734
6 SASI_Hs01_00032734 predicted 1514
7 SASI_Hs01_00032735 predicted 346
8 SASI_Hs01_00032737 predicted 2716
9 SASI_Hs01_00032738 predicted 532
10 SASI_Hs02_00333442 predicted 2014
11 SASI_Hs01_00032730 predicted 2241
12 SASI_Hs01_00032736 predicted 2006
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574079 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00189193 predicted 2637
2 SASI_Rn01_00189194 predicted 1912
3 SASI_Rn01_00189195 predicted 689
4 SASI_Rn01_00189196 predicted 2716
5 SASI_Rn01_00189197 predicted 1809
6 SASI_Rn01_00189198 predicted 873
7 SASI_Rn01_00189199 predicted 571
8 SASI_Rn01_00189200 predicted 1184
9 SASI_Rn01_00189201 predicted 2189
10 SASI_Rn01_00189202 predicted 1175
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_005459 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00409366 predicted 1877
2 SASI_Rn02_00409367 predicted 1158
3 SASI_Rn02_00409368 predicted 1963
4 SASI_Rn02_00409369 predicted 1043
5 SASI_Rn02_00409370 predicted 1119
6 SASI_Rn02_00409371 predicted 425
7 SASI_Rn02_00409372 predicted 1423
8 SASI_Rn02_00409373 predicted 2992
9 SASI_Rn02_00409374 predicted 1700
10 SASI_Rn02_00409375 predicted 2921
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009617 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00420345 predicted 1774
2 SASI_Rn02_00420346 predicted 2710
3 SASI_Rn02_00420347 predicted 1050
4 SASI_Rn02_00420348 predicted 1856
5 SASI_Rn02_00420349 predicted 701
6 SASI_Rn02_00420350 predicted 324
7 SASI_Rn02_00420351 predicted 1326
8 SASI_Rn02_00420352 predicted 2900
9 SASI_Rn02_00420353 predicted 2892
10 SASI_Rn02_00420354 predicted 1595
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010582 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067716 predicted 672
2 SASI_Mm01_00067717 predicted 1836
3 SASI_Mm01_00067718 predicted 1453
4 SASI_Mm01_00067719 predicted 1301
5 SASI_Mm01_00067720 predicted 2296
6 SASI_Mm01_00067721 predicted 349
7 SASI_Mm01_00067722 predicted 1500
8 SASI_Mm01_00067723 predicted 1649
9 SASI_Mm02_00318864 predicted 1091
10 SASI_Mm02_00318865 predicted 1732
11 SASI_Mm01_00067724 predicted 486
12 SASI_Mm01_00067725 predicted 762
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002216
ITIH2 MISSION shRNA Bacterial Glycerol Stock
inter-alpha-trypsin inhibitor heavy chain 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002216.2-387s21c1
Sequence:CCGGTAAAGTCCAGTCTACTATTACCTCGAGGTAATAGTAGACTGGACTTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002216.2-2721s21c1
Sequence:CCGGACCTAAAGCCCACGGACTAATCTCGAGATTAGTCCGTGGGCTTTAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002216.2-1764s1c1
Sequence:CCGGCCCTGCTAAATTGGATCAAATCTCGAGATTTGATCCAATTTAGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002216.2-2946s1c1
Sequence:CCGGCGGGCATTACAAGGATTACTTCTCGAGAAGTAATCCTTGTAATGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002216.2-1366s1c1
Sequence:CCGGGCCAATAACTTGGGACTGTTACTCGAGTAACAGTCCCAAGTTATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002216.2-463s1c1
Sequence:CCGGCCTCAGAATGTCGTGTTTGATCTCGAGATCAAACACGACATTCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002216.2-842s1c1
Sequence:CCGGCCGACACATTTGAAGGCCATTCTCGAGAATGGCCTTCAAATGTGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002216
ITIH2 MISSION shRNA shRNA Plasmid DNA
inter-alpha-trypsin inhibitor heavy chain 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002216.2-387s21c1
Sequence:CCGGTAAAGTCCAGTCTACTATTACCTCGAGGTAATAGTAGACTGGACTTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002216.2-2721s21c1
Sequence:CCGGACCTAAAGCCCACGGACTAATCTCGAGATTAGTCCGTGGGCTTTAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002216.2-1764s1c1
Sequence:CCGGCCCTGCTAAATTGGATCAAATCTCGAGATTTGATCCAATTTAGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002216.2-2946s1c1
Sequence:CCGGCGGGCATTACAAGGATTACTTCTCGAGAAGTAATCCTTGTAATGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002216.2-1366s1c1
Sequence:CCGGGCCAATAACTTGGGACTGTTACTCGAGTAACAGTCCCAAGTTATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002216.2-463s1c1
Sequence:CCGGCCTCAGAATGTCGTGTTTGATCTCGAGATCAAACACGACATTCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002216.2-842s1c1
Sequence:CCGGCCGACACATTTGAAGGCCATTCTCGAGAATGGCCTTCAAATGTGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002216
ITIH2 MISSION shRNA Lentiviral Transduction Particles
inter-alpha-trypsin inhibitor heavy chain 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002216.2-387s21c1
Sequence:CCGGTAAAGTCCAGTCTACTATTACCTCGAGGTAATAGTAGACTGGACTTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002216.2-2721s21c1
Sequence:CCGGACCTAAAGCCCACGGACTAATCTCGAGATTAGTCCGTGGGCTTTAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002216.2-1764s1c1
Sequence:CCGGCCCTGCTAAATTGGATCAAATCTCGAGATTTGATCCAATTTAGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002216.2-2946s1c1
Sequence:CCGGCGGGCATTACAAGGATTACTTCTCGAGAAGTAATCCTTGTAATGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002216.2-1366s1c1
Sequence:CCGGGCCAATAACTTGGGACTGTTACTCGAGTAACAGTCCCAAGTTATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002216.2-463s1c1
Sequence:CCGGCCTCAGAATGTCGTGTTTGATCTCGAGATCAAACACGACATTCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002216.2-842s1c1
Sequence:CCGGCCGACACATTTGAAGGCCATTCTCGAGAATGGCCTTCAAATGTGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010582
VALIDATED
ITIH2 MISSION shRNA Bacterial Glycerol Stock
inter-alpha-trypsin inhibitor heavy chain 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010582.3-1235s21c1
Sequence:CCGGGCCAAGAGATACATTGAGAAACTCGAGTTTCTCAATGTATCTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010582.3-2077s21c1
Sequence:CCGGCGCACTGTATTATGGCACCAACTCGAGTTGGTGCCATAATACAGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318042    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010582.3-2975s21c1
Sequence:CCGGGAAACTGTATGTGTATCCTTTCTCGAGAAAGGATACACATACAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010582.3-2899s21c1
Sequence:CCGGCGATGGACATTATAAGGATTACTCGAGTAATCCTTATAATGTCCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080233    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010582.1-2961s1c1
Sequence:CCGGGAAACTGTATGTGTATCCTTTCTCGAGAAAGGATACACATACAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010582.1-1221s1c1
Sequence:CCGGGCCAAGAGATACATTGAGAAACTCGAGTTTCTCAATGTATCTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010582.1-816s1c1
Sequence:CCGGCCTGTCATATCTAAAGGACAACTCGAGTTGTCCTTTAGATATGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010582.1-2063s1c1
Sequence:CCGGCGCACTGTATTATGGCACCAACTCGAGTTGGTGCCATAATACAGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010582.1-2885s1c1
Sequence:CCGGCGATGGACATTATAAGGATTACTCGAGTAATCCTTATAATGTCCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010582
VALIDATED
ITIH2 MISSION shRNA shRNA Plasmid DNA
inter-alpha-trypsin inhibitor heavy chain 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010582.3-1235s21c1
Sequence:CCGGGCCAAGAGATACATTGAGAAACTCGAGTTTCTCAATGTATCTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010582.3-2077s21c1
Sequence:CCGGCGCACTGTATTATGGCACCAACTCGAGTTGGTGCCATAATACAGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318042    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010582.3-2975s21c1
Sequence:CCGGGAAACTGTATGTGTATCCTTTCTCGAGAAAGGATACACATACAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010582.3-2899s21c1
Sequence:CCGGCGATGGACATTATAAGGATTACTCGAGTAATCCTTATAATGTCCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080233    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010582.1-2961s1c1
Sequence:CCGGGAAACTGTATGTGTATCCTTTCTCGAGAAAGGATACACATACAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010582.1-1221s1c1
Sequence:CCGGGCCAAGAGATACATTGAGAAACTCGAGTTTCTCAATGTATCTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010582.1-816s1c1
Sequence:CCGGCCTGTCATATCTAAAGGACAACTCGAGTTGTCCTTTAGATATGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010582.1-2063s1c1
Sequence:CCGGCGCACTGTATTATGGCACCAACTCGAGTTGGTGCCATAATACAGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010582.1-2885s1c1
Sequence:CCGGCGATGGACATTATAAGGATTACTCGAGTAATCCTTATAATGTCCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010582
VALIDATED
ITIH2 MISSION shRNA Lentiviral Transduction Particles
inter-alpha-trypsin inhibitor heavy chain 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010582.3-1235s21c1
Sequence:CCGGGCCAAGAGATACATTGAGAAACTCGAGTTTCTCAATGTATCTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010582.3-2077s21c1
Sequence:CCGGCGCACTGTATTATGGCACCAACTCGAGTTGGTGCCATAATACAGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318042    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010582.3-2975s21c1
Sequence:CCGGGAAACTGTATGTGTATCCTTTCTCGAGAAAGGATACACATACAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010582.3-2899s21c1
Sequence:CCGGCGATGGACATTATAAGGATTACTCGAGTAATCCTTATAATGTCCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080233    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010582.1-2961s1c1
Sequence:CCGGGAAACTGTATGTGTATCCTTTCTCGAGAAAGGATACACATACAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010582.1-1221s1c1
Sequence:CCGGGCCAAGAGATACATTGAGAAACTCGAGTTTCTCAATGTATCTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010582.1-816s1c1
Sequence:CCGGCCTGTCATATCTAAAGGACAACTCGAGTTGTCCTTTAGATATGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010582.1-2063s1c1
Sequence:CCGGCGCACTGTATTATGGCACCAACTCGAGTTGGTGCCATAATACAGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010582.1-2885s1c1
Sequence:CCGGCGATGGACATTATAAGGATTACTCGAGTAATCCTTATAATGTCCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)