EMAIL THIS PAGE TO A FRIEND

ITIH4

inter-alpha-trypsin inhibitor heavy chain family, member 4

55 Gene Product Result for
Synonyms: GP120 H4P IHRP ITI-HC4 ITIHL1 PK-120 PK120
UniProtKB ID: Q14624, B7Z545, E9PGN5, Q15135, Q9P190, Q9UQ54
Gene ID:
Human(3700) Summary: The protein encoded by this gene is secreted into the blood, where it is cleaved by plasma kallikrein into two smaller forms. Expression of this gene has been detected only in liver, and it seems to be upregulated during surgical trauma. This gene is part of a cluster of similar genes on chromosome 3. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Mouse(16427) inter alpha-trypsin inhibitor, heavy chain 4
Rat(54404) inter-alpha-trypsin inhibitor heavy chain family, member 4
cow(513700) inter-alpha-trypsin inhibitor heavy chain family, member 4
Horse(100059906) inter-alpha-trypsin inhibitor heavy chain family, member 4
domestic cat(101093423) inter-alpha-trypsin inhibitor heavy chain family, member 4
dog(607088) inter-alpha-trypsin inhibitor heavy chain family, member 4
domestic guinea pig(100727086) inter-alpha-trypsin inhibitor heavy chain family, member 4
naked mole-rat(101722643) inter-alpha-trypsin inhibitor heavy chain family, member 4
sheep(101108959) inter-alpha-trypsin inhibitor heavy chain family, member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0522 AQUA Peptide FAHTVVTS[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002218 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002218 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002218 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018746 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018746 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018746 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002218 Rosetta Predictions human pricing
NM_019369 Rosetta Predictions rat pricing
NM_018746 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002218 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097538 predicted 851
2 SASI_Hs01_00097539 predicted 2450
3 SASI_Hs01_00097540 predicted 966
4 SASI_Hs01_00097541 predicted 2131
5 SASI_Hs01_00097542 predicted 1577
6 SASI_Hs01_00097543 predicted 2402
7 SASI_Hs01_00097544 predicted 2489
8 SASI_Hs01_00097545 predicted 201
9 SASI_Hs01_00097546 predicted 1794
10 SASI_Hs02_00333446 predicted 1754
11 SASI_Hs01_00097547 predicted 804
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019369 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071016 predicted 1939
2 SASI_Rn01_00071017 predicted 393
3 SASI_Rn01_00071019 predicted 775
4 SASI_Rn01_00071020 predicted 2492
5 SASI_Rn01_00071021 predicted 2522
6 SASI_Rn01_00071022 predicted 432
7 SASI_Rn01_00071024 predicted 1449
8 SASI_Rn02_00262389 predicted 456
9 SASI_Rn01_00071025 predicted 856
10 SASI_Rn02_00262390 predicted 2175
11 SASI_Rn01_00071018 predicted 379
12 SASI_Rn01_00071023 predicted 1795
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018746 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047684 predicted 1330
2 SASI_Mm01_00047685 predicted 778
3 SASI_Mm01_00047686 predicted 1590
4 SASI_Mm01_00047687 predicted 1987
5 SASI_Mm01_00047688 predicted 474
6 SASI_Mm01_00047689 predicted 2318
7 SASI_Mm01_00047690 predicted 2171
8 SASI_Mm01_00047691 predicted 817
9 SASI_Mm01_00047692 predicted 1393
10 SASI_Mm01_00047693 predicted 2532
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002218
ITIH4 MISSION shRNA Bacterial Glycerol Stock
inter-alpha-trypsin inhibitor heavy chain family, member 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002218.4-1259s21c1
Sequence:CCGGTAACGTGCGGGAAGCTGTAAGCTCGAGCTTACAGCTTCCCGCACGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002218.4-1911s21c1
Sequence:CCGGGTCCACTCAGGTTCCACTTTCCTCGAGGAAAGTGGAACCTGAGTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118227    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002218.3-2925s1c1
Sequence:CCGGGTCCCACTCATTACAAATAAACTCGAGTTTATTTGTAATGAGTGGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002218.3-922s1c1
Sequence:CCGGGCCCTAATCAAGATCCTGGATCTCGAGATCCAGGATCTTGATTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002218.3-1761s1c1
Sequence:CCGGGCTGAATTTATCACTTGCCTACTCGAGTAGGCAAGTGATAAATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002218.3-68s1c1
Sequence:CCGGGCAAAGTTCTCGTCCTGCTTTCTCGAGAAAGCAGGACGAGAACTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002218.3-1760s1c1
Sequence:CCGGCGCTGAATTTATCACTTGCCTCTCGAGAGGCAAGTGATAAATTCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002218
ITIH4 MISSION shRNA shRNA Plasmid DNA
inter-alpha-trypsin inhibitor heavy chain family, member 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002218.4-1259s21c1
Sequence:CCGGTAACGTGCGGGAAGCTGTAAGCTCGAGCTTACAGCTTCCCGCACGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002218.4-1911s21c1
Sequence:CCGGGTCCACTCAGGTTCCACTTTCCTCGAGGAAAGTGGAACCTGAGTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118227    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002218.3-2925s1c1
Sequence:CCGGGTCCCACTCATTACAAATAAACTCGAGTTTATTTGTAATGAGTGGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002218.3-922s1c1
Sequence:CCGGGCCCTAATCAAGATCCTGGATCTCGAGATCCAGGATCTTGATTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002218.3-1761s1c1
Sequence:CCGGGCTGAATTTATCACTTGCCTACTCGAGTAGGCAAGTGATAAATTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002218.3-68s1c1
Sequence:CCGGGCAAAGTTCTCGTCCTGCTTTCTCGAGAAAGCAGGACGAGAACTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002218.3-1760s1c1
Sequence:CCGGCGCTGAATTTATCACTTGCCTCTCGAGAGGCAAGTGATAAATTCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002218
ITIH4 MISSION shRNA Lentiviral Transduction Particles
inter-alpha-trypsin inhibitor heavy chain family, member 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002218.4-1259s21c1
Sequence:CCGGTAACGTGCGGGAAGCTGTAAGCTCGAGCTTACAGCTTCCCGCACGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002218.4-1911s21c1
Sequence:CCGGGTCCACTCAGGTTCCACTTTCCTCGAGGAAAGTGGAACCTGAGTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118227    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002218.3-2925s1c1
Sequence:CCGGGTCCCACTCATTACAAATAAACTCGAGTTTATTTGTAATGAGTGGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002218.3-922s1c1
Sequence:CCGGGCCCTAATCAAGATCCTGGATCTCGAGATCCAGGATCTTGATTAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002218.3-1761s1c1
Sequence:CCGGGCTGAATTTATCACTTGCCTACTCGAGTAGGCAAGTGATAAATTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002218.3-68s1c1
Sequence:CCGGGCAAAGTTCTCGTCCTGCTTTCTCGAGAAAGCAGGACGAGAACTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002218.3-1760s1c1
Sequence:CCGGCGCTGAATTTATCACTTGCCTCTCGAGAGGCAAGTGATAAATTCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018746
ITIH4 MISSION shRNA Bacterial Glycerol Stock
inter-alpha-trypsin inhibitor heavy chain family, member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018746.1-2865s1c1
Sequence:CCGGCCCTGCCATGTTGTCCTCGTACTCGAGTACGAGGACAACATGGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018746.1-1595s1c1
Sequence:CCGGGCCCAACAAGAGAAGGAGTTTCTCGAGAAACTCCTTCTCTTGTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018746.1-997s1c1
Sequence:CCGGGCAAGCGACAGAAGAGAATTTCTCGAGAAATTCTCTTCTGTCGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018746.1-817s1c1
Sequence:CCGGCCTTCCTACAATGTCCAAGAACTCGAGTTCTTGGACATTGTAGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018746.1-862s1c1
Sequence:CCGGCGGATCTATGTCAGGCAAGAACTCGAGTTCTTGCCTGACATAGATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018746
ITIH4 MISSION shRNA shRNA Plasmid DNA
inter-alpha-trypsin inhibitor heavy chain family, member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018746.1-2865s1c1
Sequence:CCGGCCCTGCCATGTTGTCCTCGTACTCGAGTACGAGGACAACATGGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018746.1-1595s1c1
Sequence:CCGGGCCCAACAAGAGAAGGAGTTTCTCGAGAAACTCCTTCTCTTGTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018746.1-997s1c1
Sequence:CCGGGCAAGCGACAGAAGAGAATTTCTCGAGAAATTCTCTTCTGTCGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018746.1-817s1c1
Sequence:CCGGCCTTCCTACAATGTCCAAGAACTCGAGTTCTTGGACATTGTAGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018746.1-862s1c1
Sequence:CCGGCGGATCTATGTCAGGCAAGAACTCGAGTTCTTGCCTGACATAGATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018746
ITIH4 MISSION shRNA Lentiviral Transduction Particles
inter-alpha-trypsin inhibitor heavy chain family, member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018746.1-2865s1c1
Sequence:CCGGCCCTGCCATGTTGTCCTCGTACTCGAGTACGAGGACAACATGGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018746.1-1595s1c1
Sequence:CCGGGCCCAACAAGAGAAGGAGTTTCTCGAGAAACTCCTTCTCTTGTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018746.1-997s1c1
Sequence:CCGGGCAAGCGACAGAAGAGAATTTCTCGAGAAATTCTCTTCTGTCGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018746.1-817s1c1
Sequence:CCGGCCTTCCTACAATGTCCAAGAACTCGAGTTCTTGGACATTGTAGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018746.1-862s1c1
Sequence:CCGGCGGATCTATGTCAGGCAAGAACTCGAGTTCTTGCCTGACATAGATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)