EMAIL THIS PAGE TO A FRIEND

ITIH5

inter-alpha-trypsin inhibitor heavy chain family, member 5

89 Gene Product Result for
Synonyms: ITI-HC5
Gene ID:
Human(80760) Summary: This gene encodes a heavy chain component of one of the inter-alpha-trypsin inhibitor (ITI) family members. ITI proteins are involved in extracellular matrix stabilization and in the prevention of tumor metastasis. They are also structurally related plasma serine protease inhibitors and are composed of a light chain and varying numbers of heavy chains. This family member is thought to function as a tumor suppressor in breast and thyroid cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Mouse(209378) inter-alpha (globulin) inhibitor H5
Zebrafish(555366) inter-alpha (globulin) inhibitor H5
cow(534787) inter-alpha-trypsin inhibitor heavy chain family, member 5
Horse(100070032) inter-alpha-trypsin inhibitor heavy chain family, member 5
domestic cat(101082755) inter-alpha-trypsin inhibitor heavy chain family, member 5
dog(487136) inter-alpha-trypsin inhibitor heavy chain family, member 5
chicken(419111) inter-alpha-trypsin inhibitor heavy chain family, member 5
sheep(101114543) inter-alpha-trypsin inhibitor heavy chain family, member 5
Domestic Rabbit(100340006) inter-alpha-trypsin inhibitor heavy chain family, member 5
domestic guinea pig(100713761) inter-alpha-trypsin inhibitor heavy chain family, member 5
naked mole-rat(101725181) inter-alpha-trypsin inhibitor heavy chain family, member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172471 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172471 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172471 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001001851 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001851 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001851 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001851 Rosetta Predictions human pricing
NM_030569 Rosetta Predictions human pricing
NM_032817 Rosetta Predictions human pricing
NM_172471 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001851 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224886 predicted 1522
2 SASI_Hs01_00224887 predicted 1060
3 SASI_Hs01_00224888 predicted 1676
4 SASI_Hs01_00224889 predicted 1413
5 SASI_Hs01_00224891 predicted 979
6 SASI_Hs01_00224892 predicted 1661
7 SASI_Hs01_00224893 predicted 1801
8 SASI_Hs02_00303958 predicted 984
9 SASI_Hs02_00303959 predicted 963
10 SASI_Hs02_00303960 predicted 1129
11 SASI_Hs01_00224885 predicted 945
12 SASI_Hs01_00224890 predicted 1432
13 SASI_Hs01_00224894 predicted 1806
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030569 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100791 predicted 1520
2 SASI_Hs01_00100792 predicted 1066
3 SASI_Hs01_00100793 predicted 1676
4 SASI_Hs01_00100794 predicted 1412
5 SASI_Hs01_00100796 predicted 985
6 SASI_Hs01_00100797 predicted 1654
7 SASI_Hs01_00100798 predicted 1804
8 SASI_Hs02_00358135 predicted 981
9 SASI_Hs02_00358136 predicted 959
10 SASI_Hs02_00358137 predicted 1135
11 SASI_Hs01_00100790 predicted 943
12 SASI_Hs01_00100795 predicted 1432
13 SASI_Hs01_00100799 predicted 1806
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032817 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244865 predicted 864
2 SASI_Hs01_00244866 predicted 401
3 SASI_Hs01_00244867 predicted 1009
4 SASI_Hs01_00244868 predicted 759
5 SASI_Hs01_00244870 predicted 328
6 SASI_Hs01_00244871 predicted 1001
7 SASI_Hs01_00244872 predicted 1143
8 SASI_Hs02_00360398 predicted 323
9 SASI_Hs02_00360399 predicted 304
10 SASI_Hs02_00360400 predicted 466
11 SASI_Hs01_00244864 predicted 282
12 SASI_Hs01_00244869 predicted 776
13 SASI_Hs01_00244873 predicted 1143
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172471 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122905 predicted 2115
2 SASI_Mm01_00122906 predicted 1933
3 SASI_Mm01_00122907 predicted 2822
4 SASI_Mm01_00122908 predicted 815
5 SASI_Mm01_00122909 predicted 2269
6 SASI_Mm01_00122910 predicted 2524
7 SASI_Mm01_00122911 predicted 1300
8 SASI_Mm01_00122912 predicted 1564
9 SASI_Mm01_00122913 predicted 2856
10 SASI_Mm02_00344019 predicted 1031
11 SASI_Mm01_00122914 predicted 2619
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172471
VALIDATED
ITIH5 MISSION shRNA Bacterial Glycerol Stock
inter-alpha-trypsin inhibitor heavy chain family, member 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172471.1-437s1c1
Sequence:CCGGCCTCAGACGATAATGAAGAAACTCGAGTTTCTTCATTATCGTCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172471.1-215s1c1
Sequence:CCGGCGGTGAAGTCTACCATCATTTCTCGAGAAATGATGGTAGACTTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172471.1-804s1c1
Sequence:CCGGGAATGGGATCTTGGGAGATTTCTCGAGAAATCTCCCAAGATCCCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172471.1-2617s1c1
Sequence:CCGGCCTGAGGAATACGGCAAGAATCTCGAGATTCTTGCCGTATTCCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172471.1-2929s1c1
Sequence:CCGGTCTACTCTGGACGCAACTCTTCTCGAGAAGAGTTGCGTCCAGAGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172471.2-287s21c1
Sequence:CCGGCGGTGAAGTCTACCATCATTTCTCGAGAAATGATGGTAGACTTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172471.2-509s21c1
Sequence:CCGGCCTCAGACGATAATGAAGAAACTCGAGTTTCTTCATTATCGTCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172471.2-876s21c1
Sequence:CCGGGAATGGGATCTTGGGAGATTTCTCGAGAAATCTCCCAAGATCCCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172471.2-2689s21c1
Sequence:CCGGCCTGAGGAATACGGCAAGAATCTCGAGATTCTTGCCGTATTCCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172471
VALIDATED
ITIH5 MISSION shRNA shRNA Plasmid DNA
inter-alpha-trypsin inhibitor heavy chain family, member 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172471.1-437s1c1
Sequence:CCGGCCTCAGACGATAATGAAGAAACTCGAGTTTCTTCATTATCGTCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172471.1-215s1c1
Sequence:CCGGCGGTGAAGTCTACCATCATTTCTCGAGAAATGATGGTAGACTTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172471.1-804s1c1
Sequence:CCGGGAATGGGATCTTGGGAGATTTCTCGAGAAATCTCCCAAGATCCCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172471.1-2617s1c1
Sequence:CCGGCCTGAGGAATACGGCAAGAATCTCGAGATTCTTGCCGTATTCCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172471.1-2929s1c1
Sequence:CCGGTCTACTCTGGACGCAACTCTTCTCGAGAAGAGTTGCGTCCAGAGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172471.2-287s21c1
Sequence:CCGGCGGTGAAGTCTACCATCATTTCTCGAGAAATGATGGTAGACTTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172471.2-509s21c1
Sequence:CCGGCCTCAGACGATAATGAAGAAACTCGAGTTTCTTCATTATCGTCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172471.2-876s21c1
Sequence:CCGGGAATGGGATCTTGGGAGATTTCTCGAGAAATCTCCCAAGATCCCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172471.2-2689s21c1
Sequence:CCGGCCTGAGGAATACGGCAAGAATCTCGAGATTCTTGCCGTATTCCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172471
VALIDATED
ITIH5 MISSION shRNA Lentiviral Transduction Particles
inter-alpha-trypsin inhibitor heavy chain family, member 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172471.1-437s1c1
Sequence:CCGGCCTCAGACGATAATGAAGAAACTCGAGTTTCTTCATTATCGTCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172471.1-215s1c1
Sequence:CCGGCGGTGAAGTCTACCATCATTTCTCGAGAAATGATGGTAGACTTCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172471.1-804s1c1
Sequence:CCGGGAATGGGATCTTGGGAGATTTCTCGAGAAATCTCCCAAGATCCCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172471.1-2617s1c1
Sequence:CCGGCCTGAGGAATACGGCAAGAATCTCGAGATTCTTGCCGTATTCCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172471.1-2929s1c1
Sequence:CCGGTCTACTCTGGACGCAACTCTTCTCGAGAAGAGTTGCGTCCAGAGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172471.2-287s21c1
Sequence:CCGGCGGTGAAGTCTACCATCATTTCTCGAGAAATGATGGTAGACTTCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172471.2-509s21c1
Sequence:CCGGCCTCAGACGATAATGAAGAAACTCGAGTTTCTTCATTATCGTCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172471.2-876s21c1
Sequence:CCGGGAATGGGATCTTGGGAGATTTCTCGAGAAATCTCCCAAGATCCCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172471.2-2689s21c1
Sequence:CCGGCCTGAGGAATACGGCAAGAATCTCGAGATTCTTGCCGTATTCCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001851
ITIH5 MISSION shRNA Bacterial Glycerol Stock
inter-alpha-trypsin inhibitor heavy chain family, member 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118262    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001851.1-2539s1c1
Sequence:CCGGGCACATAGAAACTCTCAGAAACTCGAGTTTCTGAGAGTTTCTATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001851.1-1492s1c1
Sequence:CCGGCATCGGGTTCTACGATGAAATCTCGAGATTTCATCGTAGAACCCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001851.1-1372s1c1
Sequence:CCGGCTGCATCTTCACCATTGGCATCTCGAGATGCCAATGGTGAAGATGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001851.1-1066s1c1
Sequence:CCGGCCGTTTCAGTATCATTGGATTCTCGAGAATCCAATGATACTGAAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001851.1-749s1c1
Sequence:CCGGCCATCTACTGTCATTAACCAACTCGAGTTGGTTAATGACAGTAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001851.1-393s21c1
Sequence:CCGGAGGTGTATCAGGGCGAAATTACTCGAGTAATTTCGCCCTGATACACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001851.1-1602s21c1
Sequence:CCGGACGGCTCGGAGATCATCATTGCTCGAGCAATGATGATCTCCGAGCCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001851.1-855s21c1
Sequence:CCGGTCATTAGATATGACGTCAATACTCGAGTATTGACGTCATATCTAATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001851.1-243s21c1
Sequence:CCGGCAGTGAAGTCTACCATCATTTCTCGAGAAATGATGGTAGACTTCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001851
ITIH5 MISSION shRNA shRNA Plasmid DNA
inter-alpha-trypsin inhibitor heavy chain family, member 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118262    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001851.1-2539s1c1
Sequence:CCGGGCACATAGAAACTCTCAGAAACTCGAGTTTCTGAGAGTTTCTATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001851.1-1492s1c1
Sequence:CCGGCATCGGGTTCTACGATGAAATCTCGAGATTTCATCGTAGAACCCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001851.1-1372s1c1
Sequence:CCGGCTGCATCTTCACCATTGGCATCTCGAGATGCCAATGGTGAAGATGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001851.1-1066s1c1
Sequence:CCGGCCGTTTCAGTATCATTGGATTCTCGAGAATCCAATGATACTGAAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001851.1-749s1c1
Sequence:CCGGCCATCTACTGTCATTAACCAACTCGAGTTGGTTAATGACAGTAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001851.1-393s21c1
Sequence:CCGGAGGTGTATCAGGGCGAAATTACTCGAGTAATTTCGCCCTGATACACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001851.1-1602s21c1
Sequence:CCGGACGGCTCGGAGATCATCATTGCTCGAGCAATGATGATCTCCGAGCCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001851.1-855s21c1
Sequence:CCGGTCATTAGATATGACGTCAATACTCGAGTATTGACGTCATATCTAATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001851.1-243s21c1
Sequence:CCGGCAGTGAAGTCTACCATCATTTCTCGAGAAATGATGGTAGACTTCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001851
ITIH5 MISSION shRNA Lentiviral Transduction Particles
inter-alpha-trypsin inhibitor heavy chain family, member 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118262    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001851.1-2539s1c1
Sequence:CCGGGCACATAGAAACTCTCAGAAACTCGAGTTTCTGAGAGTTTCTATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001851.1-1492s1c1
Sequence:CCGGCATCGGGTTCTACGATGAAATCTCGAGATTTCATCGTAGAACCCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001851.1-1372s1c1
Sequence:CCGGCTGCATCTTCACCATTGGCATCTCGAGATGCCAATGGTGAAGATGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001851.1-1066s1c1
Sequence:CCGGCCGTTTCAGTATCATTGGATTCTCGAGAATCCAATGATACTGAAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001851.1-749s1c1
Sequence:CCGGCCATCTACTGTCATTAACCAACTCGAGTTGGTTAATGACAGTAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001851.1-393s21c1
Sequence:CCGGAGGTGTATCAGGGCGAAATTACTCGAGTAATTTCGCCCTGATACACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001851.1-1602s21c1
Sequence:CCGGACGGCTCGGAGATCATCATTGCTCGAGCAATGATGATCTCCGAGCCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001851.1-855s21c1
Sequence:CCGGTCATTAGATATGACGTCAATACTCGAGTATTGACGTCATATCTAATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001851.1-243s21c1
Sequence:CCGGCAGTGAAGTCTACCATCATTTCTCGAGAAATGATGGTAGACTTCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)