EMAIL THIS PAGE TO A FRIEND

ITIH6

inter-alpha-trypsin inhibitor heavy chain family, member 6

80 Gene Product Result for
Synonyms: ITIH5L UNQ6369 dJ14O9.1
UniProtKB ID: Q6UXX5, A6NN03
Gene ID:
Human(347365) Summary: The protein encoded by this gene belongs to the interalpha trypsin inhibitor heavy chain (ITIH) family. Interalpha trypsin inhibitor (ITI) is composed of two heavy chains (containing VWA domain) and one light chain. The light chain confers the protease-inhibitor function, while the heavy chains are involved in mediating protein-protein interactions with the components of the extracellular matrix. [provided by RefSeq, Sep 2009]
Rat(100912775) inter-alpha-trypsin inhibitor heavy chain family, member 6
sheep(101108111) inter-alpha-trypsin inhibitor heavy chain family, member 6
Zebrafish(565328) inter-alpha-trypsin inhibitor heavy chain family, member 6
dog(100688889) inter-alpha-trypsin inhibitor heavy chain family, member 6
chicken(430871) inter-alpha-trypsin inhibitor heavy chain family, member 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA000506 Anti-ITIH6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198510 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198510 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198510 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU061421 MISSION® esiRNA esiRNA human ITIH5L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198510 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198510 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108273 predicted 2884
2 SASI_Hs01_00108274 predicted 1365
3 SASI_Hs01_00108276 predicted 1723
4 SASI_Hs01_00108277 predicted 1264
5 SASI_Hs02_00372079 predicted 2916
6 SASI_Hs01_00108278 predicted 1510
7 SASI_Hs01_00108279 predicted 289
8 SASI_Hs01_00108280 predicted 2447
9 SASI_Hs01_00108281 predicted 2608
10 SASI_Hs02_00372080 predicted 3230
11 SASI_Hs01_00108275 predicted 2017
12 SASI_Hs01_00108282 predicted 208
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198510
ITIH6 MISSION shRNA Bacterial Glycerol Stock
inter-alpha-trypsin inhibitor heavy chain family, member 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198510.2-2265s21c1
Sequence:CCGGACACCAGAATCCTGATATATTCTCGAGAATATATCAGGATTCTGGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198510.2-2420s21c1
Sequence:CCGGTCACATCACAGGCACCTAAAGCTCGAGCTTTAGGTGCCTGTGATGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198510.2-4287s21c1
Sequence:CCGGCCTAACTCCTATGGCATATTCCTCGAGGAATATGCCATAGGAGTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198510.2-283s21c1
Sequence:CCGGACTATGACCATCAACAATAAACTCGAGTTTATTGTTGATGGTCATAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198510.1-3194s1c1
Sequence:CCGGGCATGGAATCTCAAGGAAGTTCTCGAGAACTTCCTTGAGATTCCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198510.1-811s1c1
Sequence:CCGGGTGCAGATTTACGATGACTATCTCGAGATAGTCATCGTAAATCTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198510.1-810s1c1
Sequence:CCGGCGTGCAGATTTACGATGACTACTCGAGTAGTCATCGTAAATCTGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118507    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198510.1-4093s1c1
Sequence:CCGGCGCATGTTCTAAGGAACACATCTCGAGATGTGTTCCTTAGAACATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198510.1-2042s1c1
Sequence:CCGGCCTCAACTACTACTGCCTCTACTCGAGTAGAGGCAGTAGTAGTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198510
ITIH6 MISSION shRNA shRNA Plasmid DNA
inter-alpha-trypsin inhibitor heavy chain family, member 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198510.2-2265s21c1
Sequence:CCGGACACCAGAATCCTGATATATTCTCGAGAATATATCAGGATTCTGGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198510.2-2420s21c1
Sequence:CCGGTCACATCACAGGCACCTAAAGCTCGAGCTTTAGGTGCCTGTGATGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198510.2-4287s21c1
Sequence:CCGGCCTAACTCCTATGGCATATTCCTCGAGGAATATGCCATAGGAGTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198510.2-283s21c1
Sequence:CCGGACTATGACCATCAACAATAAACTCGAGTTTATTGTTGATGGTCATAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198510.1-3194s1c1
Sequence:CCGGGCATGGAATCTCAAGGAAGTTCTCGAGAACTTCCTTGAGATTCCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198510.1-811s1c1
Sequence:CCGGGTGCAGATTTACGATGACTATCTCGAGATAGTCATCGTAAATCTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198510.1-810s1c1
Sequence:CCGGCGTGCAGATTTACGATGACTACTCGAGTAGTCATCGTAAATCTGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118507    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198510.1-4093s1c1
Sequence:CCGGCGCATGTTCTAAGGAACACATCTCGAGATGTGTTCCTTAGAACATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198510.1-2042s1c1
Sequence:CCGGCCTCAACTACTACTGCCTCTACTCGAGTAGAGGCAGTAGTAGTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198510
ITIH6 MISSION shRNA Lentiviral Transduction Particles
inter-alpha-trypsin inhibitor heavy chain family, member 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198510.2-2265s21c1
Sequence:CCGGACACCAGAATCCTGATATATTCTCGAGAATATATCAGGATTCTGGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198510.2-2420s21c1
Sequence:CCGGTCACATCACAGGCACCTAAAGCTCGAGCTTTAGGTGCCTGTGATGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198510.2-4287s21c1
Sequence:CCGGCCTAACTCCTATGGCATATTCCTCGAGGAATATGCCATAGGAGTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198510.2-283s21c1
Sequence:CCGGACTATGACCATCAACAATAAACTCGAGTTTATTGTTGATGGTCATAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198510.1-3194s1c1
Sequence:CCGGGCATGGAATCTCAAGGAAGTTCTCGAGAACTTCCTTGAGATTCCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198510.1-811s1c1
Sequence:CCGGGTGCAGATTTACGATGACTATCTCGAGATAGTCATCGTAAATCTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198510.1-810s1c1
Sequence:CCGGCGTGCAGATTTACGATGACTACTCGAGTAGTCATCGTAAATCTGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118507    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198510.1-4093s1c1
Sequence:CCGGCGCATGTTCTAAGGAACACATCTCGAGATGTGTTCCTTAGAACATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198510.1-2042s1c1
Sequence:CCGGCCTCAACTACTACTGCCTCTACTCGAGTAGAGGCAGTAGTAGTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)