EMAIL THIS PAGE TO A FRIEND

ITK

IL2-inducible T-cell kinase

103 Gene Product Result for
Synonyms: EMT LPFS1 LYK PSCTK2
UniProtKB ID: Q08881, B2R752, Q32ML7
Gene ID:
Human(3702) Summary: This gene encodes an intracellular tyrosine kinase expressed in T-cells. The protein contains both SH2 and SH3 domains which are often found in intracellular kinases. It is thought to play a role in T-cell proliferation and differentiation. [provided by RefSeq, Jul 2008]
Mouse(16428) IL2 inducible T cell kinase
Rat(363577) IL2-inducible T-cell kinase
Zebrafish(798906) IL2-inducible T-cell kinase
chicken(416247) IL2-inducible T-cell kinase
cow(522311) IL2-inducible T-cell kinase
Horse(100071232) IL2-inducible T-cell kinase
domestic cat(101100785) IL2-inducible T-cell kinase
dog(489159) IL2-inducible T-cell kinase
domestic guinea pig(100722647) IL2-inducible T-cell kinase
naked mole-rat(101710258) IL2-inducible T-cell kinase
sheep(101112899) IL2-inducible T-cell kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0969 Phosphotyrosine ITK / Tyrosine-protein Kinase ITK/TSK ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005546 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005546 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005546 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010583 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010583 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010583 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU018911 MISSION® esiRNA esiRNA targeting human ITK (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005546 Rosetta Predictions human pricing
NM_001108825 Rosetta Predictions rat pricing
NM_010583 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005546 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020242 predicted 1500
2 SASI_Hs01_00020243 predicted 603
3 SASI_Hs01_00020245 predicted 1992
4 SASI_Hs01_00020246 predicted 1876
5 SASI_Hs01_00020247 predicted 252
6 SASI_Hs01_00020248 predicted 511
7 SASI_Hs01_00020249 predicted 1274
8 SASI_Hs01_00020250 predicted 1191
9 SASI_Hs02_00339789 predicted 1287
10 SASI_Hs01_00020251 predicted 726
11 SASI_Hs01_00020244 predicted 966
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108825 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242445 predicted 276
2 SASI_Rn02_00242446 predicted 455
3 SASI_Rn02_00242447 predicted 431
4 SASI_Rn02_00242448 predicted 1736
5 SASI_Rn02_00242449 predicted 1730
6 SASI_Rn02_00242450 predicted 885
7 SASI_Rn02_00242451 predicted 633
8 SASI_Rn02_00242452 predicted 1796
9 SASI_Rn02_00242453 predicted 1590
10 SASI_Rn02_00242454 predicted 1267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010583 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318866 predicted 1289
2 SASI_Mm01_00195988 predicted 1957
3 SASI_Mm01_00195989 predicted 1736
4 SASI_Mm02_00318867 predicted 452
5 SASI_Mm01_00195990 predicted 747
6 SASI_Mm01_00195991 predicted 629
7 SASI_Mm01_00195992 predicted 1605
8 SASI_Mm01_00195993 predicted 234
9 SASI_Mm01_00195994 predicted 1787
10 SASI_Mm01_00195995 predicted 244
11 SASI_Mm01_00195987 predicted 286
12 SASI_Mm01_00195996 predicted 1270
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005546
VALIDATED
ITK MISSION shRNA Bacterial Glycerol Stock
IL2-inducible T-cell kinase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_005546.x-1612s1c1
Sequence:CCGGTCAGTACACCAGTTCCACAGGCTCGAGCCTGTGGAACTGGTGTACTGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005546.x-430s1c1
Sequence:CCGGGGTGCCTAAATATCATCCTAACTCGAGTTAGGATGATATTTAGGCACCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005546.x-1831s1c1
Sequence:CCGGCTCCACACACGTCTACCAGATCTCGAGATCTGGTAGACGTGTGTGGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_005546.x-614s1c1
Sequence:CCGGGCCTTATATGACTACCAAACCCTCGAGGGTTTGGTAGTCATATAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_005546.3-1787s1c1
Sequence:CCGGGAAGACATCAGTACCGGATTTCTCGAGAAATCCGGTACTGATGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005546.3-167s1c1
Sequence:CCGGCGCTTCTTTGTGTTAACCAAACTCGAGTTTGGTTAACACAAAGAAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_005546.3-1039s1c1
Sequence:CCGGCATCAACTATCACCAACATAACTCGAGTTATGTTGGTGATAGTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005546.3-258s1c1
Sequence:CCGGGAATCAAATGTGTTGAGATTGCTCGAGCAATCTCAACACATTTGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_005546.3-933s1c1
Sequence:CCGGGTGAGAACAATCCCTGTATAACTCGAGTTATACAGGGATTGTTCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005546
VALIDATED
ITK MISSION shRNA shRNA Plasmid DNA
IL2-inducible T-cell kinase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_005546.x-1612s1c1
Sequence:CCGGTCAGTACACCAGTTCCACAGGCTCGAGCCTGTGGAACTGGTGTACTGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005546.x-430s1c1
Sequence:CCGGGGTGCCTAAATATCATCCTAACTCGAGTTAGGATGATATTTAGGCACCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005546.x-1831s1c1
Sequence:CCGGCTCCACACACGTCTACCAGATCTCGAGATCTGGTAGACGTGTGTGGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_005546.x-614s1c1
Sequence:CCGGGCCTTATATGACTACCAAACCCTCGAGGGTTTGGTAGTCATATAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_005546.3-1787s1c1
Sequence:CCGGGAAGACATCAGTACCGGATTTCTCGAGAAATCCGGTACTGATGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005546.3-167s1c1
Sequence:CCGGCGCTTCTTTGTGTTAACCAAACTCGAGTTTGGTTAACACAAAGAAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_005546.3-1039s1c1
Sequence:CCGGCATCAACTATCACCAACATAACTCGAGTTATGTTGGTGATAGTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005546.3-258s1c1
Sequence:CCGGGAATCAAATGTGTTGAGATTGCTCGAGCAATCTCAACACATTTGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_005546.3-933s1c1
Sequence:CCGGGTGAGAACAATCCCTGTATAACTCGAGTTATACAGGGATTGTTCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005546
VALIDATED
ITK MISSION shRNA Lentiviral Transduction Particles
IL2-inducible T-cell kinase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_005546.x-1612s1c1
Sequence:CCGGTCAGTACACCAGTTCCACAGGCTCGAGCCTGTGGAACTGGTGTACTGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005546.x-430s1c1
Sequence:CCGGGGTGCCTAAATATCATCCTAACTCGAGTTAGGATGATATTTAGGCACCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005546.x-1831s1c1
Sequence:CCGGCTCCACACACGTCTACCAGATCTCGAGATCTGGTAGACGTGTGTGGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_005546.x-614s1c1
Sequence:CCGGGCCTTATATGACTACCAAACCCTCGAGGGTTTGGTAGTCATATAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_005546.3-1787s1c1
Sequence:CCGGGAAGACATCAGTACCGGATTTCTCGAGAAATCCGGTACTGATGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005546.3-167s1c1
Sequence:CCGGCGCTTCTTTGTGTTAACCAAACTCGAGTTTGGTTAACACAAAGAAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_005546.3-1039s1c1
Sequence:CCGGCATCAACTATCACCAACATAACTCGAGTTATGTTGGTGATAGTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005546.3-258s1c1
Sequence:CCGGGAATCAAATGTGTTGAGATTGCTCGAGCAATCTCAACACATTTGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_005546.3-933s1c1
Sequence:CCGGGTGAGAACAATCCCTGTATAACTCGAGTTATACAGGGATTGTTCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010583
ITK MISSION shRNA Bacterial Glycerol Stock
IL2-inducible T-cell kinase
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010583.1-310s1c1
Sequence:CCGGCGTGCCACTATAAATACCCTTCTCGAGAAGGGTATTTATAGTGGCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010583.1-177s1c1
Sequence:CCGGCGTTTCTTTGTCTTAACGAAACTCGAGTTTCGTTAAGACAAAGAAACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010583.1-1076s1c1
Sequence:CCGGCCAGTACAATGGAGGAGGTTTCTCGAGAAACCTCCTCCATTGTACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010583.2-315s21c1
Sequence:CCGGTAGCATCCCGTGCCACTATAACTCGAGTTATAGTGGCACGGGATGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010583.2-1816s21c1
Sequence:CCGGAGCACTGGCTTTCGGTTATACCTCGAGGTATAACCGAAAGCCAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010583.2-2405s21c1
Sequence:CCGGGAAATGCAAGAGGTGATTAAACTCGAGTTTAATCACCTCTTGCATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010583.2-455s21c1
Sequence:CCGGTATCCAAGTATCACCCTAATTCTCGAGAATTAGGGTGATACTTGGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010583
ITK MISSION shRNA shRNA Plasmid DNA
IL2-inducible T-cell kinase
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010583.1-310s1c1
Sequence:CCGGCGTGCCACTATAAATACCCTTCTCGAGAAGGGTATTTATAGTGGCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010583.1-177s1c1
Sequence:CCGGCGTTTCTTTGTCTTAACGAAACTCGAGTTTCGTTAAGACAAAGAAACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010583.1-1076s1c1
Sequence:CCGGCCAGTACAATGGAGGAGGTTTCTCGAGAAACCTCCTCCATTGTACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010583.2-315s21c1
Sequence:CCGGTAGCATCCCGTGCCACTATAACTCGAGTTATAGTGGCACGGGATGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010583.2-1816s21c1
Sequence:CCGGAGCACTGGCTTTCGGTTATACCTCGAGGTATAACCGAAAGCCAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010583.2-2405s21c1
Sequence:CCGGGAAATGCAAGAGGTGATTAAACTCGAGTTTAATCACCTCTTGCATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010583.2-455s21c1
Sequence:CCGGTATCCAAGTATCACCCTAATTCTCGAGAATTAGGGTGATACTTGGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010583
ITK MISSION shRNA Lentiviral Transduction Particles
IL2-inducible T-cell kinase
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010583.1-310s1c1
Sequence:CCGGCGTGCCACTATAAATACCCTTCTCGAGAAGGGTATTTATAGTGGCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010583.1-177s1c1
Sequence:CCGGCGTTTCTTTGTCTTAACGAAACTCGAGTTTCGTTAAGACAAAGAAACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010583.1-1076s1c1
Sequence:CCGGCCAGTACAATGGAGGAGGTTTCTCGAGAAACCTCCTCCATTGTACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010583.2-315s21c1
Sequence:CCGGTAGCATCCCGTGCCACTATAACTCGAGTTATAGTGGCACGGGATGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010583.2-1816s21c1
Sequence:CCGGAGCACTGGCTTTCGGTTATACCTCGAGGTATAACCGAAAGCCAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010583.2-2405s21c1
Sequence:CCGGGAAATGCAAGAGGTGATTAAACTCGAGTTTAATCACCTCTTGCATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010583.2-455s21c1
Sequence:CCGGTATCCAAGTATCACCCTAATTCTCGAGAATTAGGGTGATACTTGGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)