EMAIL THIS PAGE TO A FRIEND

ITLN1

intelectin 1 (galactofuranose binding)

51 Gene Product Result for
Synonyms: HL-1 HL1 INTL ITLN LFR hIntL omentin
UniProtKB ID: Q8WWA0, Q5IWS4, Q5VYI4, Q6YDJ3, Q9NP67
Gene ID:
Mouse(16429) intelectin 1 (galactofuranose binding)
Rat(498284) intelectin 1 (galactofuranose binding)
domestic guinea pig(100723437) intelectin 1 (galactofuranose binding)
Zebrafish(767684) intelectin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010584 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010584 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010584 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017625 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017625 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017625 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU131361 MISSION® esiRNA esiRNA human ITLN1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017625 Rosetta Predictions human pricing
NM_001034946 Rosetta Predictions rat pricing
NM_010584 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017625 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096834 predicted 289
2 SASI_Hs01_00096835 predicted 684
3 SASI_Hs01_00096837 predicted 265
4 SASI_Hs01_00096838 predicted 793
5 SASI_Hs01_00096839 predicted 907
6 SASI_Hs01_00096840 predicted 794
7 SASI_Hs01_00096841 predicted 260
8 SASI_Hs01_00096842 predicted 249
9 SASI_Hs01_00096843 predicted 200
10 SASI_Hs02_00350300 predicted 612
11 SASI_Hs01_00096836 predicted 788
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034946 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107369 predicted 217
2 SASI_Rn01_00107370 predicted 833
3 SASI_Rn01_00107371 predicted 771
4 SASI_Rn01_00107372 predicted 402
5 SASI_Rn01_00107373 predicted 624
6 SASI_Rn01_00107374 predicted 654
7 SASI_Rn01_00107375 predicted 801
8 SASI_Rn01_00107376 predicted 451
9 SASI_Rn01_00107377 predicted 707
10 SASI_Rn01_00107378 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010584 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144936 predicted 759
2 SASI_Mm02_00318868 predicted 675
3 SASI_Mm02_00318869 predicted 915
4 SASI_Mm02_00318870 predicted 689
5 SASI_Mm01_00144938 predicted 415
6 SASI_Mm02_00318871 predicted 666
7 SASI_Mm01_00144940 predicted 728
8 SASI_Mm01_00144941 predicted 257
9 SASI_Mm02_00318872 predicted 683
10 SASI_Mm02_00318873 predicted 773
11 SASI_Mm01_00144937 predicted 680
12 SASI_Mm01_00144939 predicted 689
13 SASI_Mm01_00144942 predicted 690
14 SASI_Mm01_00144943 predicted 427
15 SASI_Mm01_00144944 predicted 732
16 SASI_Mm01_00144945 predicted 919
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010584
ITLN1 MISSION shRNA Bacterial Glycerol Stock
intelectin 1 (galactofuranose binding)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010584.1-929s1c1
Sequence:CCGGGCTTCATTTGATTGGGATGGACTCGAGTCCATCCCAATCAAATGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010584.1-701s1c1
Sequence:CCGGCCTGTAGTCTATGACTTTGGTCTCGAGACCAAAGTCATAGACTACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010584.1-692s1c1
Sequence:CCGGCCAGCATTACCTGTAGTCTATCTCGAGATAGACTACAGGTAATGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010584.1-726s1c1
Sequence:CCGGCTCGGAAGACAGCCTCTTATTCTCGAGAATAAGAGGCTGTCTTCCGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010584.1-256s1c1
Sequence:CCGGCACGAAGAATGGTGTCATCTACTCGAGTAGATGACACCATTCTTCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010584
ITLN1 MISSION shRNA shRNA Plasmid DNA
intelectin 1 (galactofuranose binding)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010584.1-929s1c1
Sequence:CCGGGCTTCATTTGATTGGGATGGACTCGAGTCCATCCCAATCAAATGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010584.1-701s1c1
Sequence:CCGGCCTGTAGTCTATGACTTTGGTCTCGAGACCAAAGTCATAGACTACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010584.1-692s1c1
Sequence:CCGGCCAGCATTACCTGTAGTCTATCTCGAGATAGACTACAGGTAATGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010584.1-726s1c1
Sequence:CCGGCTCGGAAGACAGCCTCTTATTCTCGAGAATAAGAGGCTGTCTTCCGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010584.1-256s1c1
Sequence:CCGGCACGAAGAATGGTGTCATCTACTCGAGTAGATGACACCATTCTTCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010584
ITLN1 MISSION shRNA Lentiviral Transduction Particles
intelectin 1 (galactofuranose binding)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010584.1-929s1c1
Sequence:CCGGGCTTCATTTGATTGGGATGGACTCGAGTCCATCCCAATCAAATGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010584.1-701s1c1
Sequence:CCGGCCTGTAGTCTATGACTTTGGTCTCGAGACCAAAGTCATAGACTACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010584.1-692s1c1
Sequence:CCGGCCAGCATTACCTGTAGTCTATCTCGAGATAGACTACAGGTAATGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010584.1-726s1c1
Sequence:CCGGCTCGGAAGACAGCCTCTTATTCTCGAGAATAAGAGGCTGTCTTCCGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010584.1-256s1c1
Sequence:CCGGCACGAAGAATGGTGTCATCTACTCGAGTAGATGACACCATTCTTCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017625
ITLN1 MISSION shRNA Bacterial Glycerol Stock
intelectin 1 (galactofuranose binding)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164302    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017625.2-642s1c1
Sequence:CCGGCTCCAGACACTGGGACATAATCTCGAGATTATGTCCCAGTGTCTGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017625.2-293s1c1
Sequence:CCGGCACTGAGAATGGTGTTATCTACTCGAGTAGATAACACCATTCTCAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017625.2-238s1c1
Sequence:CCGGGCAAGGAAATCAAAGACGAATCTCGAGATTCGTCTTTGATTTCCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017625.2-774s1c1
Sequence:CCGGGCATCTTATTACTCACCCTATCTCGAGATAGGGTGAGTAATAAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017625.2-255s1c1
Sequence:CCGGGAATGTCCTAGTGCATTTGATCTCGAGATCAAATGCACTAGGACATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017625.2-180s1c1
Sequence:CCGGGCTAATACTTACTTCAAGGAACTCGAGTTCCTTGAAGTAAGTATTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017625.2-469s1c1
Sequence:CCGGCCAACTACAACACCTTTGGATCTCGAGATCCAAAGGTGTTGTAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017625.2-688s1c1
Sequence:CCGGCAGTGAAATATGGAGAAGGAACTCGAGTTCCTTCTCCATATTTCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017625.2-687s1c1
Sequence:CCGGCCAGTGAAATATGGAGAAGGACTCGAGTCCTTCTCCATATTTCACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017625.2-985s1c1
Sequence:CCGGGATATGGAACTCATGTTGGTTCTCGAGAACCAACATGAGTTCCATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017625
ITLN1 MISSION shRNA shRNA Plasmid DNA
intelectin 1 (galactofuranose binding)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164302    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017625.2-642s1c1
Sequence:CCGGCTCCAGACACTGGGACATAATCTCGAGATTATGTCCCAGTGTCTGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017625.2-293s1c1
Sequence:CCGGCACTGAGAATGGTGTTATCTACTCGAGTAGATAACACCATTCTCAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017625.2-238s1c1
Sequence:CCGGGCAAGGAAATCAAAGACGAATCTCGAGATTCGTCTTTGATTTCCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017625.2-774s1c1
Sequence:CCGGGCATCTTATTACTCACCCTATCTCGAGATAGGGTGAGTAATAAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017625.2-255s1c1
Sequence:CCGGGAATGTCCTAGTGCATTTGATCTCGAGATCAAATGCACTAGGACATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017625.2-180s1c1
Sequence:CCGGGCTAATACTTACTTCAAGGAACTCGAGTTCCTTGAAGTAAGTATTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017625.2-469s1c1
Sequence:CCGGCCAACTACAACACCTTTGGATCTCGAGATCCAAAGGTGTTGTAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017625.2-688s1c1
Sequence:CCGGCAGTGAAATATGGAGAAGGAACTCGAGTTCCTTCTCCATATTTCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017625.2-687s1c1
Sequence:CCGGCCAGTGAAATATGGAGAAGGACTCGAGTCCTTCTCCATATTTCACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017625.2-985s1c1
Sequence:CCGGGATATGGAACTCATGTTGGTTCTCGAGAACCAACATGAGTTCCATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017625
ITLN1 MISSION shRNA Lentiviral Transduction Particles
intelectin 1 (galactofuranose binding)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164302    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017625.2-642s1c1
Sequence:CCGGCTCCAGACACTGGGACATAATCTCGAGATTATGTCCCAGTGTCTGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017625.2-293s1c1
Sequence:CCGGCACTGAGAATGGTGTTATCTACTCGAGTAGATAACACCATTCTCAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017625.2-238s1c1
Sequence:CCGGGCAAGGAAATCAAAGACGAATCTCGAGATTCGTCTTTGATTTCCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017625.2-774s1c1
Sequence:CCGGGCATCTTATTACTCACCCTATCTCGAGATAGGGTGAGTAATAAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017625.2-255s1c1
Sequence:CCGGGAATGTCCTAGTGCATTTGATCTCGAGATCAAATGCACTAGGACATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017625.2-180s1c1
Sequence:CCGGGCTAATACTTACTTCAAGGAACTCGAGTTCCTTGAAGTAAGTATTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017625.2-469s1c1
Sequence:CCGGCCAACTACAACACCTTTGGATCTCGAGATCCAAAGGTGTTGTAGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017625.2-688s1c1
Sequence:CCGGCAGTGAAATATGGAGAAGGAACTCGAGTTCCTTCTCCATATTTCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017625.2-687s1c1
Sequence:CCGGCCAGTGAAATATGGAGAAGGACTCGAGTCCTTCTCCATATTTCACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017625.2-985s1c1
Sequence:CCGGGATATGGAACTCATGTTGGTTCTCGAGAACCAACATGAGTTCCATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)