EMAIL THIS PAGE TO A FRIEND

ITLN2

intelectin 2

21 Gene Product Result for
Synonyms: HL-2 HL2
UniProtKB ID: Q8WWU7, Q5VYI0
Gene ID:
cow(508016) intelectin 2
cow(618581) intelectin 2
sheep(100125357) intelectin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080878 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080878 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080878 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU104771 MISSION® esiRNA esiRNA human ITLN2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080878 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080878 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155749 predicted 739
2 SASI_Hs01_00155752 predicted 718
3 SASI_Hs01_00155754 predicted 763
4 SASI_Hs01_00155755 predicted 794
5 SASI_Hs01_00155756 predicted 760
6 SASI_Hs01_00155757 predicted 797
7 SASI_Hs01_00155758 predicted 774
8 SASI_Hs02_00362676 predicted 794
9 SASI_Hs02_00362677 predicted 588
10 SASI_Hs02_00362678 predicted 893
11 SASI_Hs01_00155750 predicted 688
12 SASI_Hs01_00155751 predicted 231
13 SASI_Hs01_00155753 predicted 272
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080878
ITLN2 MISSION shRNA Bacterial Glycerol Stock
intelectin 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080878.2-963s1c1
Sequence:CCGGGATATGGAACTCACGTTAAGACTCGAGTCTTAACGTGAGTTCCATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080878.2-724s1c1
Sequence:CCGGCTATGACTTTGGTGATGCTAACTCGAGTTAGCATCACCAAAGTCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080878.2-86s21c1
Sequence:CCGGAGACTCTGCTTCCTGTTATTCCTCGAGGAATAACAGGAAGCAGAGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080878.2-710s21c1
Sequence:CCGGGCCATACCTGTGGTCTATGACCTCGAGGTCATAGACCACAGGTATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080878.2-740s1c1
Sequence:CCGGGCTAAGAAGACTGCATCTTATCTCGAGATAAGATGCAGTCTTCTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080878.2-799s1c1
Sequence:CCGGCGTTCAGTTCCGGGTGTTTAACTCGAGTTAAACACCCGGAACTGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080878.2-270s1c1
Sequence:CCGGGCACCAAGAATGGTGTTGTCTCTCGAGAGACAACACCATTCTTGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080878.2-221s1c1
Sequence:CCGGGAAATCAAGGAACGCTGCCATCTCGAGATGGCAGCGTTCCTTGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080878.2-1011s21c1
Sequence:CCGCCGGCTGTACTCTTGTTCTATACTCGAGTATAGAACAAGAGTACAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080878
ITLN2 MISSION shRNA shRNA Plasmid DNA
intelectin 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080878.2-963s1c1
Sequence:CCGGGATATGGAACTCACGTTAAGACTCGAGTCTTAACGTGAGTTCCATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080878.2-724s1c1
Sequence:CCGGCTATGACTTTGGTGATGCTAACTCGAGTTAGCATCACCAAAGTCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080878.2-86s21c1
Sequence:CCGGAGACTCTGCTTCCTGTTATTCCTCGAGGAATAACAGGAAGCAGAGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080878.2-710s21c1
Sequence:CCGGGCCATACCTGTGGTCTATGACCTCGAGGTCATAGACCACAGGTATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080878.2-740s1c1
Sequence:CCGGGCTAAGAAGACTGCATCTTATCTCGAGATAAGATGCAGTCTTCTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080878.2-799s1c1
Sequence:CCGGCGTTCAGTTCCGGGTGTTTAACTCGAGTTAAACACCCGGAACTGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080878.2-270s1c1
Sequence:CCGGGCACCAAGAATGGTGTTGTCTCTCGAGAGACAACACCATTCTTGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080878.2-221s1c1
Sequence:CCGGGAAATCAAGGAACGCTGCCATCTCGAGATGGCAGCGTTCCTTGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080878.2-1011s21c1
Sequence:CCGCCGGCTGTACTCTTGTTCTATACTCGAGTATAGAACAAGAGTACAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080878
ITLN2 MISSION shRNA Lentiviral Transduction Particles
intelectin 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080878.2-963s1c1
Sequence:CCGGGATATGGAACTCACGTTAAGACTCGAGTCTTAACGTGAGTTCCATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080878.2-724s1c1
Sequence:CCGGCTATGACTTTGGTGATGCTAACTCGAGTTAGCATCACCAAAGTCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080878.2-86s21c1
Sequence:CCGGAGACTCTGCTTCCTGTTATTCCTCGAGGAATAACAGGAAGCAGAGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080878.2-710s21c1
Sequence:CCGGGCCATACCTGTGGTCTATGACCTCGAGGTCATAGACCACAGGTATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080878.2-740s1c1
Sequence:CCGGGCTAAGAAGACTGCATCTTATCTCGAGATAAGATGCAGTCTTCTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080878.2-799s1c1
Sequence:CCGGCGTTCAGTTCCGGGTGTTTAACTCGAGTTAAACACCCGGAACTGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080878.2-270s1c1
Sequence:CCGGGCACCAAGAATGGTGTTGTCTCTCGAGAGACAACACCATTCTTGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080878.2-221s1c1
Sequence:CCGGGAAATCAAGGAACGCTGCCATCTCGAGATGGCAGCGTTCCTTGATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080878.2-1011s21c1
Sequence:CCGCCGGCTGTACTCTTGTTCTATACTCGAGTATAGAACAAGAGTACAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)