EMAIL THIS PAGE TO A FRIEND

ITM2A

integral membrane protein 2A

80 Gene Product Result for
Synonyms: BRICD2A E25A
UniProtKB ID: O43736, B2R7X5, B4E062
Gene ID:
Human(9452) Summary: This gene encodes a type II membrane protein that belongs to the ITM2 family. Studies in mouse suggest that it may be involved in osteo- and chondrogenic differentiation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]
Mouse(16431) integral membrane protein 2A
Rat(317218) integral membrane protein 2A
chicken(422145) integral membrane protein 2A
domestic cat(101088221) integral membrane protein 2A
cow(100299798) integral membrane protein 2A
sheep(101107256) integral membrane protein 2A
domestic guinea pig(100735285) integral membrane protein 2A
naked mole-rat(101709255) integral membrane protein 2A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004867 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004867 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004867 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008409 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008409 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008409 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004867 Rosetta Predictions human pricing
NM_001025712 Rosetta Predictions rat pricing
NM_008409 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004867 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158843 predicted 942
2 SASI_Hs01_00158845 predicted 494
3 SASI_Hs01_00158846 predicted 980
4 SASI_Hs01_00158847 predicted 885
5 SASI_Hs01_00158848 predicted 938
6 SASI_Hs01_00158850 predicted 500
7 SASI_Hs02_00338491 predicted 670
8 SASI_Hs01_00158852 predicted 828
9 SASI_Hs02_00338492 predicted 576
10 SASI_Hs02_00338493 predicted 886
11 SASI_Hs01_00158844 predicted 755
12 SASI_Hs01_00158849 predicted 825
13 SASI_Hs01_00158851 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025712 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036693 predicted 443
2 SASI_Rn01_00036694 predicted 521
3 SASI_Rn01_00036695 predicted 237
4 SASI_Rn01_00036696 predicted 977
5 SASI_Rn01_00036697 predicted 657
6 SASI_Rn01_00036698 predicted 597
7 SASI_Rn01_00036699 predicted 988
8 SASI_Rn01_00036700 predicted 360
9 SASI_Rn01_00036701 predicted 515
10 SASI_Rn01_00036702 predicted 619
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008409 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020436 predicted 1018
2 SASI_Mm01_00020437 predicted 636
3 SASI_Mm01_00020438 predicted 951
4 SASI_Mm01_00020439 predicted 910
5 SASI_Mm01_00020441 predicted 657
6 SASI_Mm01_00020442 predicted 944
7 SASI_Mm01_00020443 predicted 317
8 SASI_Mm01_00020444 predicted 1030
9 SASI_Mm01_00020445 predicted 892
10 SASI_Mm02_00313855 predicted 399
11 SASI_Mm01_00020440 predicted 1026
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004867
ITM2A MISSION shRNA Bacterial Glycerol Stock
integral membrane protein 2A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004867.4-1221s21c1
Sequence:CCGGACTCATGCATTTACTCTATTGCTCGAGCAATAGAGTAAATGCATGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004867.4-1407s21c1
Sequence:CCGGACCTAACATCCTGACAATAAACTCGAGTTTATTGTCAGGATGTTAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004867.4-1140s21c1
Sequence:CCGGATAGAGTGTCCTTGGTAATAACTCGAGTTATTACCAAGGACACTCTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117892    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004867.2-1419s1c1
Sequence:CCGGCCTGACTTATATGTGAACAATCTCGAGATTGTTCACATATAAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004867.2-583s1c1
Sequence:CCGGCCCTCAATACTTCTATTGTTACTCGAGTAACAATAGAAGTATTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004867.2-245s1c1
Sequence:CCGGGAGATGTATGCTTACTCTCTTCTCGAGAAGAGAGTAAGCATACATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004867.2-238s1c1
Sequence:CCGGCCTCTGGGAGATGTATGCTTACTCGAGTAAGCATACATCTCCCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004867.2-696s1c1
Sequence:CCGGGTGGAGGAAATTCGTGATGTTCTCGAGAACATCACGAATTTCCTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004867.4-744s21c1
Sequence:CCGGGTGACCCTGCAGCAATTATTCCTCGAGGAATAATTGCTGCAGGGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004867.4-896s21c1
Sequence:CCGGAGATATCTGCCTCAAACTTATCTCGAGATAAGTTTGAGGCAGATATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004867
ITM2A MISSION shRNA shRNA Plasmid DNA
integral membrane protein 2A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004867.4-1221s21c1
Sequence:CCGGACTCATGCATTTACTCTATTGCTCGAGCAATAGAGTAAATGCATGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004867.4-1407s21c1
Sequence:CCGGACCTAACATCCTGACAATAAACTCGAGTTTATTGTCAGGATGTTAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004867.4-1140s21c1
Sequence:CCGGATAGAGTGTCCTTGGTAATAACTCGAGTTATTACCAAGGACACTCTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117892    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004867.2-1419s1c1
Sequence:CCGGCCTGACTTATATGTGAACAATCTCGAGATTGTTCACATATAAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004867.2-583s1c1
Sequence:CCGGCCCTCAATACTTCTATTGTTACTCGAGTAACAATAGAAGTATTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004867.2-245s1c1
Sequence:CCGGGAGATGTATGCTTACTCTCTTCTCGAGAAGAGAGTAAGCATACATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004867.2-238s1c1
Sequence:CCGGCCTCTGGGAGATGTATGCTTACTCGAGTAAGCATACATCTCCCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004867.2-696s1c1
Sequence:CCGGGTGGAGGAAATTCGTGATGTTCTCGAGAACATCACGAATTTCCTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004867.4-744s21c1
Sequence:CCGGGTGACCCTGCAGCAATTATTCCTCGAGGAATAATTGCTGCAGGGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004867.4-896s21c1
Sequence:CCGGAGATATCTGCCTCAAACTTATCTCGAGATAAGTTTGAGGCAGATATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004867
ITM2A MISSION shRNA Lentiviral Transduction Particles
integral membrane protein 2A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004867.4-1221s21c1
Sequence:CCGGACTCATGCATTTACTCTATTGCTCGAGCAATAGAGTAAATGCATGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004867.4-1407s21c1
Sequence:CCGGACCTAACATCCTGACAATAAACTCGAGTTTATTGTCAGGATGTTAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004867.4-1140s21c1
Sequence:CCGGATAGAGTGTCCTTGGTAATAACTCGAGTTATTACCAAGGACACTCTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117892    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004867.2-1419s1c1
Sequence:CCGGCCTGACTTATATGTGAACAATCTCGAGATTGTTCACATATAAGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004867.2-583s1c1
Sequence:CCGGCCCTCAATACTTCTATTGTTACTCGAGTAACAATAGAAGTATTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004867.2-245s1c1
Sequence:CCGGGAGATGTATGCTTACTCTCTTCTCGAGAAGAGAGTAAGCATACATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004867.2-238s1c1
Sequence:CCGGCCTCTGGGAGATGTATGCTTACTCGAGTAAGCATACATCTCCCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004867.2-696s1c1
Sequence:CCGGGTGGAGGAAATTCGTGATGTTCTCGAGAACATCACGAATTTCCTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004867.4-744s21c1
Sequence:CCGGGTGACCCTGCAGCAATTATTCCTCGAGGAATAATTGCTGCAGGGTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004867.4-896s21c1
Sequence:CCGGAGATATCTGCCTCAAACTTATCTCGAGATAAGTTTGAGGCAGATATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008409
VALIDATED
ITM2A MISSION shRNA Bacterial Glycerol Stock
integral membrane protein 2A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008409.2-559s1c1
Sequence:CCGGGCGGCAATTATTCACGACTTTCTCGAGAAAGTCGTGAATAATTGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008409.2-661s1c1
Sequence:CCGGCCAAAGAATCTGGTGGAACTTCTCGAGAAGTTCCACCAGATTCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008409.2-763s1c1
Sequence:CCGGGATGTTAGTAACCTTGGTATTCTCGAGAATACCAAGGTTACTAACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008409.2-635s1c1
Sequence:CCGGCCCTCAATACTTCCATTGTTACTCGAGTAACAATGGAAGTATTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008409.2-1204s1c1
Sequence:CCGGGCAGCATGAATGTGTCATCTTCTCGAGAAGATGACACATTCATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008409
VALIDATED
ITM2A MISSION shRNA shRNA Plasmid DNA
integral membrane protein 2A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008409.2-559s1c1
Sequence:CCGGGCGGCAATTATTCACGACTTTCTCGAGAAAGTCGTGAATAATTGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008409.2-661s1c1
Sequence:CCGGCCAAAGAATCTGGTGGAACTTCTCGAGAAGTTCCACCAGATTCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008409.2-763s1c1
Sequence:CCGGGATGTTAGTAACCTTGGTATTCTCGAGAATACCAAGGTTACTAACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008409.2-635s1c1
Sequence:CCGGCCCTCAATACTTCCATTGTTACTCGAGTAACAATGGAAGTATTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008409.2-1204s1c1
Sequence:CCGGGCAGCATGAATGTGTCATCTTCTCGAGAAGATGACACATTCATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008409
VALIDATED
ITM2A MISSION shRNA Lentiviral Transduction Particles
integral membrane protein 2A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008409.2-559s1c1
Sequence:CCGGGCGGCAATTATTCACGACTTTCTCGAGAAAGTCGTGAATAATTGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008409.2-661s1c1
Sequence:CCGGCCAAAGAATCTGGTGGAACTTCTCGAGAAGTTCCACCAGATTCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008409.2-763s1c1
Sequence:CCGGGATGTTAGTAACCTTGGTATTCTCGAGAATACCAAGGTTACTAACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008409.2-635s1c1
Sequence:CCGGCCCTCAATACTTCCATTGTTACTCGAGTAACAATGGAAGTATTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008409.2-1204s1c1
Sequence:CCGGGCAGCATGAATGTGTCATCTTCTCGAGAAGATGACACATTCATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)