EMAIL THIS PAGE TO A FRIEND

ITM2B

integral membrane protein 2B

110 Gene Product Result for
Synonyms: ABRI BRI BRI2 BRICD2B E25B E3-16 FBD imBRI2
UniProtKB ID: Q9Y287, Q9NYH1
Gene ID:
Human(9445) Summary: Amyloid precursor proteins are processed by beta-secretase and gamma-secretase to produce beta-amyloid peptides which form the characteristic plaques of Alzheimer disease. This gene encodes a transmembrane protein which is processed at the C-terminus by furin or furin-like proteases to produce a small secreted peptide which inhibits the deposition of beta-amyloid. Mutations which result in extension of the C-terminal end of the encoded protein, thereby increasing the size of the secreted peptide, are associated with two neurogenerative diseases, familial British dementia and familial Danish dementia. [provided by RefSeq, Oct 2009]
Mouse(16432) integral membrane protein 2B
Rat(290364) integral membrane protein 2B
domestic guinea pig(100716017) integral membrane protein 2B
naked mole-rat(101704426) integral membrane protein 2B
sheep(100174988) integral membrane protein 2B
chicken(395969) integral membrane protein 2B
dog(476916) integral membrane protein 2B
cow(510575) integral membrane protein 2B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008410 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008410 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008410 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021999 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021999 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021999 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021999 Rosetta Predictions human pricing
NM_001006963 Rosetta Predictions rat pricing
NM_008410 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021999 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178675 predicted 715
2 SASI_Hs01_00178676 predicted 663
3 SASI_Hs01_00178678 predicted 631
4 SASI_Hs01_00178679 predicted 787
5 SASI_Hs01_00178680 predicted 676
6 SASI_Hs01_00178682 predicted 613
7 SASI_Hs02_00355367 predicted 617
8 SASI_Hs02_00355368 predicted 697
9 SASI_Hs01_00178684 predicted 749
10 SASI_Hs02_00355369 predicted 713
11 SASI_Hs01_00178677 predicted 542
12 SASI_Hs01_00178681 predicted 395
13 SASI_Hs01_00178683 predicted 469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006963 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076459 predicted 860
2 SASI_Rn01_00076460 predicted 580
3 SASI_Rn01_00076461 predicted 531
4 SASI_Rn01_00076462 predicted 663
5 SASI_Rn01_00076463 predicted 728
6 SASI_Rn01_00076464 predicted 692
7 SASI_Rn01_00076465 predicted 1376
8 SASI_Rn01_00076466 predicted 620
9 SASI_Rn01_00076467 predicted 865
10 SASI_Rn01_00076468 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008410 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035546 predicted 477
2 SASI_Mm01_00035547 predicted 847
3 SASI_Mm01_00035549 predicted 567
4 SASI_Mm01_00035550 predicted 654
5 SASI_Mm01_00035552 predicted 605
6 SASI_Mm02_00313856 predicted 1426
7 SASI_Mm02_00313857 predicted 1416
8 SASI_Mm02_00313858 predicted 1433
9 SASI_Mm01_00035553 predicted 399
10 SASI_Mm01_00035554 predicted 500
11 SASI_Mm01_00035548 predicted 1399
12 SASI_Mm01_00035551 predicted 643
13 SASI_Mm01_00035555 predicted 1367
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008410
VALIDATED
ITM2B MISSION shRNA Bacterial Glycerol Stock
integral membrane protein 2B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112240    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008410.1-1146s1c1
Sequence:CCGGGCGTCTTTGATGTTTGAATTACTCGAGTAATTCAAACATCAAAGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008410.1-725s1c1
Sequence:CCGGCCTCAGTCCTACCTTATCCATCTCGAGATGGATAAGGTAGGACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008410.1-845s1c1
Sequence:CCGGCGGGAAACAATTAGAGGTATTCTCGAGAATACCTCTAATTGTTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008410.1-604s1c1
Sequence:CCGGCACTGCTTATTTGGACCTTAACTCGAGTTAAGGTCCAAATAAGCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008410.1-603s1c1
Sequence:CCGGTCACTGCTTATTTGGACCTTACTCGAGTAAGGTCCAAATAAGCAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008410.2-816s21c1
Sequence:CCGGACGACAAGGAGACCTACAAACCTCGAGGTTTGTAGGTCTCCTTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008410.2-725s21c1
Sequence:CCGGCCTCAGTCCTACCTTATCCATCTCGAGATGGATAAGGTAGGACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008410.2-401s21c1
Sequence:CCGGGTGTACTACTGTGGACTAAAGCTCGAGCTTTAGTCCACAGTAGTACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008410.2-1387s21c1
Sequence:CCGGTCACCTTCTCATACTACTTTACTCGAGTAAAGTAGTATGAGAAGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008410.2-360s21c1
Sequence:CCGGGGGCGTACCTGTACAAGTATTCTCGAGAATACTTGTACAGGTACGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008410
VALIDATED
ITM2B MISSION shRNA shRNA Plasmid DNA
integral membrane protein 2B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112240    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008410.1-1146s1c1
Sequence:CCGGGCGTCTTTGATGTTTGAATTACTCGAGTAATTCAAACATCAAAGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008410.1-725s1c1
Sequence:CCGGCCTCAGTCCTACCTTATCCATCTCGAGATGGATAAGGTAGGACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008410.1-845s1c1
Sequence:CCGGCGGGAAACAATTAGAGGTATTCTCGAGAATACCTCTAATTGTTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008410.1-604s1c1
Sequence:CCGGCACTGCTTATTTGGACCTTAACTCGAGTTAAGGTCCAAATAAGCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008410.1-603s1c1
Sequence:CCGGTCACTGCTTATTTGGACCTTACTCGAGTAAGGTCCAAATAAGCAGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008410.2-816s21c1
Sequence:CCGGACGACAAGGAGACCTACAAACCTCGAGGTTTGTAGGTCTCCTTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008410.2-725s21c1
Sequence:CCGGCCTCAGTCCTACCTTATCCATCTCGAGATGGATAAGGTAGGACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008410.2-401s21c1
Sequence:CCGGGTGTACTACTGTGGACTAAAGCTCGAGCTTTAGTCCACAGTAGTACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008410.2-1387s21c1
Sequence:CCGGTCACCTTCTCATACTACTTTACTCGAGTAAAGTAGTATGAGAAGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008410.2-360s21c1
Sequence:CCGGGGGCGTACCTGTACAAGTATTCTCGAGAATACTTGTACAGGTACGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008410
VALIDATED
ITM2B MISSION shRNA Lentiviral Transduction Particles
integral membrane protein 2B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112240    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008410.1-1146s1c1
Sequence:CCGGGCGTCTTTGATGTTTGAATTACTCGAGTAATTCAAACATCAAAGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008410.1-725s1c1
Sequence:CCGGCCTCAGTCCTACCTTATCCATCTCGAGATGGATAAGGTAGGACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008410.1-845s1c1
Sequence:CCGGCGGGAAACAATTAGAGGTATTCTCGAGAATACCTCTAATTGTTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008410.1-604s1c1
Sequence:CCGGCACTGCTTATTTGGACCTTAACTCGAGTTAAGGTCCAAATAAGCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008410.1-603s1c1
Sequence:CCGGTCACTGCTTATTTGGACCTTACTCGAGTAAGGTCCAAATAAGCAGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008410.2-816s21c1
Sequence:CCGGACGACAAGGAGACCTACAAACCTCGAGGTTTGTAGGTCTCCTTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008410.2-725s21c1
Sequence:CCGGCCTCAGTCCTACCTTATCCATCTCGAGATGGATAAGGTAGGACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008410.2-401s21c1
Sequence:CCGGGTGTACTACTGTGGACTAAAGCTCGAGCTTTAGTCCACAGTAGTACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008410.2-1387s21c1
Sequence:CCGGTCACCTTCTCATACTACTTTACTCGAGTAAAGTAGTATGAGAAGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008410.2-360s21c1
Sequence:CCGGGGGCGTACCTGTACAAGTATTCTCGAGAATACTTGTACAGGTACGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021999
VALIDATED
ITM2B MISSION shRNA Bacterial Glycerol Stock
integral membrane protein 2B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021999.2-467s1c1
Sequence:CCGGCGTGTACTACTGTGGAATAAACTCGAGTTTATTCCACAGTAGTACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021999.2-333s1c1
Sequence:CCGGCCAGATGATGTGGTACCAGTTCTCGAGAACTGGTACCACATCATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_021999.2-910s1c1
Sequence:CCGGGCAGAGAAACTATTAAAGGTACTCGAGTACCTTTAATAGTTTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_021999.2-988s1c1
Sequence:CCGGCCGTGGAAACTTTAATTTGTTCTCGAGAACAAATTAAAGTTTCCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_021999.2-741s1c1
Sequence:CCGGCCCAGAAACCTACTGGAGTTACTCGAGTAACTCCAGTAGGTTTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021999.4-478s21c1
Sequence:CCGGCGTGTACTACTGTGGAATAAACTCGAGTTTATTCCACAGTAGTACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021999.4-752s21c1
Sequence:CCGGCCCAGAAACCTACTGGAGTTACTCGAGTAACTCCAGTAGGTTTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021999.4-344s21c1
Sequence:CCGGCCAGATGATGTGGTACCAGTTCTCGAGAACTGGTACCACATCATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021999.4-999s21c1
Sequence:CCGGCCGTGGAAACTTTAATTTGTTCTCGAGAACAAATTAAAGTTTCCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021999
VALIDATED
ITM2B MISSION shRNA shRNA Plasmid DNA
integral membrane protein 2B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021999.2-467s1c1
Sequence:CCGGCGTGTACTACTGTGGAATAAACTCGAGTTTATTCCACAGTAGTACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021999.2-333s1c1
Sequence:CCGGCCAGATGATGTGGTACCAGTTCTCGAGAACTGGTACCACATCATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_021999.2-910s1c1
Sequence:CCGGGCAGAGAAACTATTAAAGGTACTCGAGTACCTTTAATAGTTTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_021999.2-988s1c1
Sequence:CCGGCCGTGGAAACTTTAATTTGTTCTCGAGAACAAATTAAAGTTTCCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_021999.2-741s1c1
Sequence:CCGGCCCAGAAACCTACTGGAGTTACTCGAGTAACTCCAGTAGGTTTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021999.4-478s21c1
Sequence:CCGGCGTGTACTACTGTGGAATAAACTCGAGTTTATTCCACAGTAGTACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021999.4-752s21c1
Sequence:CCGGCCCAGAAACCTACTGGAGTTACTCGAGTAACTCCAGTAGGTTTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021999.4-344s21c1
Sequence:CCGGCCAGATGATGTGGTACCAGTTCTCGAGAACTGGTACCACATCATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021999.4-999s21c1
Sequence:CCGGCCGTGGAAACTTTAATTTGTTCTCGAGAACAAATTAAAGTTTCCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021999
VALIDATED
ITM2B MISSION shRNA Lentiviral Transduction Particles
integral membrane protein 2B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021999.2-467s1c1
Sequence:CCGGCGTGTACTACTGTGGAATAAACTCGAGTTTATTCCACAGTAGTACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021999.2-333s1c1
Sequence:CCGGCCAGATGATGTGGTACCAGTTCTCGAGAACTGGTACCACATCATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_021999.2-910s1c1
Sequence:CCGGGCAGAGAAACTATTAAAGGTACTCGAGTACCTTTAATAGTTTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_021999.2-988s1c1
Sequence:CCGGCCGTGGAAACTTTAATTTGTTCTCGAGAACAAATTAAAGTTTCCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_021999.2-741s1c1
Sequence:CCGGCCCAGAAACCTACTGGAGTTACTCGAGTAACTCCAGTAGGTTTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021999.4-478s21c1
Sequence:CCGGCGTGTACTACTGTGGAATAAACTCGAGTTTATTCCACAGTAGTACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021999.4-752s21c1
Sequence:CCGGCCCAGAAACCTACTGGAGTTACTCGAGTAACTCCAGTAGGTTTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021999.4-344s21c1
Sequence:CCGGCCAGATGATGTGGTACCAGTTCTCGAGAACTGGTACCACATCATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021999.4-999s21c1
Sequence:CCGGCCGTGGAAACTTTAATTTGTTCTCGAGAACAAATTAAAGTTTCCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)