EMAIL THIS PAGE TO A FRIEND

ITM2C

integral membrane protein 2C

101 Gene Product Result for
Synonyms: BRI3 BRICD2C E25 E25C ITM3
Gene ID:
Mouse(64294) integral membrane protein 2C
Rat(301575) integral membrane protein 2C
chicken(424831) integral membrane protein 2C
domestic cat(101090636) integral membrane protein 2C
cow(539959) integral membrane protein 2C
dog(486156) integral membrane protein 2C
sheep(100174906) integral membrane protein 2C
domestic guinea pig(101788315) integral membrane protein 2C
naked mole-rat(101697097) integral membrane protein 2C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022417 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022417 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022417 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030926 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030926 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030926 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012514 Rosetta Predictions human pricing
NM_001012516 Rosetta Predictions human pricing
NM_030926 Rosetta Predictions human pricing
NM_001009674 Rosetta Predictions rat pricing
NM_022417 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012514 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175774 predicted 880
2 SASI_Hs01_00175775 predicted 864
3 SASI_Hs01_00175777 predicted 879
4 SASI_Hs01_00175779 predicted 863
5 SASI_Hs01_00175780 predicted 934
6 SASI_Hs01_00175782 predicted 1215
7 SASI_Hs01_00175776 predicted 887
8 SASI_Hs01_00175783 predicted 1161
9 SASI_Hs02_00306185 predicted 1025
10 SASI_Hs02_00306186 predicted 432
11 SASI_Hs01_00175778 predicted 893
12 SASI_Hs01_00175781 predicted 901
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012516 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212800 predicted 910
2 SASI_Hs01_00212801 predicted 898
3 SASI_Hs01_00212803 predicted 911
4 SASI_Hs01_00212805 predicted 892
5 SASI_Hs01_00212806 predicted 964
6 SASI_Hs01_00212808 predicted 1244
7 SASI_Hs01_00212802 predicted 916
8 SASI_Hs01_00212809 predicted 1196
9 SASI_Hs02_00306191 predicted 1049
10 SASI_Hs02_00306192 predicted 665
11 SASI_Hs01_00212804 predicted 927
12 SASI_Hs01_00212807 predicted 932
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030926 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030629 predicted 993
2 SASI_Hs01_00030630 predicted 1021
3 SASI_Hs01_00030631 predicted 1001
4 SASI_Hs01_00030632 predicted 1021
5 SASI_Hs01_00030633 predicted 1026
6 SASI_Hs01_00030634 predicted 1007
7 SASI_Hs01_00030635 predicted 570
8 SASI_Hs01_00030636 predicted 584
9 SASI_Hs01_00030637 predicted 775
10 SASI_Hs01_00030638 predicted 602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009674 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068899 predicted 496
2 SASI_Rn01_00068900 predicted 340
3 SASI_Rn01_00068901 predicted 827
4 SASI_Rn02_00199711 predicted 537
5 SASI_Rn01_00068903 predicted 440
6 SASI_Rn01_00068904 predicted 314
7 SASI_Rn01_00068906 predicted 329
8 SASI_Rn02_00199712 predicted 957
9 SASI_Rn01_00068907 predicted 974
10 SASI_Rn01_00068908 predicted 639
11 SASI_Rn01_00068902 predicted 688
12 SASI_Rn01_00068905 predicted 955
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022417 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053790 predicted 906
2 SASI_Mm02_00326592 predicted 1443
3 SASI_Mm01_00053791 predicted 643
4 SASI_Mm01_00053792 predicted 854
5 SASI_Mm01_00053793 predicted 524
6 SASI_Mm01_00053794 predicted 583
7 SASI_Mm01_00053795 predicted 643
8 SASI_Mm01_00053796 predicted 766
9 SASI_Mm01_00053797 predicted 399
10 SASI_Mm01_00053799 predicted 1034
11 SASI_Mm01_00053798 predicted 359
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022417
VALIDATED
ITM2C MISSION shRNA Bacterial Glycerol Stock
integral membrane protein 2C
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354236    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022417.3-1185s21c1
Sequence:CCGGCGCCCAAGATGGTTTCTCTAACTCGAGTTAGAGAAACCATCTTGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022417.3-195s21c1
Sequence:CCGGAGGCTGATAAAGCGGACAAAGCTCGAGCTTTGTCCGCTTTATCAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022417.3-343s21c1
Sequence:CCGGGTCCATGGGCATGGTTGTATTCTCGAGAATACAACCATGCCCATGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022417.3-527s21c1
Sequence:CCGGGAGGAGAACTATGAACGTATTCTCGAGAATACGTTCATAGTTCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022417.3-911s21c1
Sequence:CCGGCGCCACTTCGAGAATACATTTCTCGAGAAATGTATTCTCGAAGTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022417.1-1128s1c1
Sequence:CCGGCGCCCAAGATGGTTTCTCTAACTCGAGTTAGAGAAACCATCTTGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022417.1-854s1c1
Sequence:CCGGCGCCACTTCGAGAATACATTTCTCGAGAAATGTATTCTCGAAGTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022417.1-471s1c1
Sequence:CCGGAGGAGAACTATGAACGTATTACTCGAGTAATACGTTCATAGTTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022417.1-470s1c1
Sequence:CCGGGAGGAGAACTATGAACGTATTCTCGAGAATACGTTCATAGTTCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022417.1-128s1c1
Sequence:CCGGGTCGCCATCAAGGCTGATAAACTCGAGTTTATCAGCCTTGATGGCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022417
VALIDATED
ITM2C MISSION shRNA shRNA Plasmid DNA
integral membrane protein 2C
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354236    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022417.3-1185s21c1
Sequence:CCGGCGCCCAAGATGGTTTCTCTAACTCGAGTTAGAGAAACCATCTTGGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022417.3-195s21c1
Sequence:CCGGAGGCTGATAAAGCGGACAAAGCTCGAGCTTTGTCCGCTTTATCAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022417.3-343s21c1
Sequence:CCGGGTCCATGGGCATGGTTGTATTCTCGAGAATACAACCATGCCCATGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022417.3-527s21c1
Sequence:CCGGGAGGAGAACTATGAACGTATTCTCGAGAATACGTTCATAGTTCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022417.3-911s21c1
Sequence:CCGGCGCCACTTCGAGAATACATTTCTCGAGAAATGTATTCTCGAAGTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022417.1-1128s1c1
Sequence:CCGGCGCCCAAGATGGTTTCTCTAACTCGAGTTAGAGAAACCATCTTGGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022417.1-854s1c1
Sequence:CCGGCGCCACTTCGAGAATACATTTCTCGAGAAATGTATTCTCGAAGTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022417.1-471s1c1
Sequence:CCGGAGGAGAACTATGAACGTATTACTCGAGTAATACGTTCATAGTTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022417.1-470s1c1
Sequence:CCGGGAGGAGAACTATGAACGTATTCTCGAGAATACGTTCATAGTTCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022417.1-128s1c1
Sequence:CCGGGTCGCCATCAAGGCTGATAAACTCGAGTTTATCAGCCTTGATGGCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022417
VALIDATED
ITM2C MISSION shRNA Lentiviral Transduction Particles
integral membrane protein 2C
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354236    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022417.3-1185s21c1
Sequence:CCGGCGCCCAAGATGGTTTCTCTAACTCGAGTTAGAGAAACCATCTTGGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022417.3-195s21c1
Sequence:CCGGAGGCTGATAAAGCGGACAAAGCTCGAGCTTTGTCCGCTTTATCAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022417.3-343s21c1
Sequence:CCGGGTCCATGGGCATGGTTGTATTCTCGAGAATACAACCATGCCCATGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022417.3-527s21c1
Sequence:CCGGGAGGAGAACTATGAACGTATTCTCGAGAATACGTTCATAGTTCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022417.3-911s21c1
Sequence:CCGGCGCCACTTCGAGAATACATTTCTCGAGAAATGTATTCTCGAAGTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022417.1-1128s1c1
Sequence:CCGGCGCCCAAGATGGTTTCTCTAACTCGAGTTAGAGAAACCATCTTGGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022417.1-854s1c1
Sequence:CCGGCGCCACTTCGAGAATACATTTCTCGAGAAATGTATTCTCGAAGTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022417.1-471s1c1
Sequence:CCGGAGGAGAACTATGAACGTATTACTCGAGTAATACGTTCATAGTTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022417.1-470s1c1
Sequence:CCGGGAGGAGAACTATGAACGTATTCTCGAGAATACGTTCATAGTTCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022417.1-128s1c1
Sequence:CCGGGTCGCCATCAAGGCTGATAAACTCGAGTTTATCAGCCTTGATGGCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030926
ITM2C MISSION shRNA Bacterial Glycerol Stock
integral membrane protein 2C
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030926.3-597s1c1
Sequence:CCGGGACAAGTGCTATGTCATCGAACTCGAGTTCGATGACATAGCACTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030926.3-604s1c1
Sequence:CCGGGCTATGTCATCGAACTCAACACTCGAGTGTTGAGTTCGATGACATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030926.3-384s1c1
Sequence:CCGGCGAGATAACTTCTTCCGCTGTCTCGAGACAGCGGAAGAAGTTATCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030926.3-540s1c1
Sequence:CCGGGCAGACATCATCCATGACTTCCTCGAGGAAGTCATGGATGATGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030926.3-453s1c1
Sequence:CCGGGAGCTGGAAGAGGATGTGAAACTCGAGTTTCACATCCTCTTCCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030926.4-1009s1c1
Sequence:CCGGGCTTGTACTTTGGACGCGTTTCTCGAGAAACGCGTCCAAAGTACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030926.3-387s1c1
Sequence:CCGGGATAACTTCTTCCGCTGTGGTCTCGAGACCACAGCGGAAGAAGTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030926.3-614s1c1
Sequence:CCGGCGAACTCAACACCACCATTGTCTCGAGACAATGGTGGTGTTGAGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030926.3-335s1c1
Sequence:CCGGGTTCGCCTCTGTCTACATCTACTCGAGTAGATGTAGACAGAGGCGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030926
ITM2C MISSION shRNA shRNA Plasmid DNA
integral membrane protein 2C
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030926.3-597s1c1
Sequence:CCGGGACAAGTGCTATGTCATCGAACTCGAGTTCGATGACATAGCACTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030926.3-604s1c1
Sequence:CCGGGCTATGTCATCGAACTCAACACTCGAGTGTTGAGTTCGATGACATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030926.3-384s1c1
Sequence:CCGGCGAGATAACTTCTTCCGCTGTCTCGAGACAGCGGAAGAAGTTATCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030926.3-540s1c1
Sequence:CCGGGCAGACATCATCCATGACTTCCTCGAGGAAGTCATGGATGATGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030926.3-453s1c1
Sequence:CCGGGAGCTGGAAGAGGATGTGAAACTCGAGTTTCACATCCTCTTCCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030926.4-1009s1c1
Sequence:CCGGGCTTGTACTTTGGACGCGTTTCTCGAGAAACGCGTCCAAAGTACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030926.3-387s1c1
Sequence:CCGGGATAACTTCTTCCGCTGTGGTCTCGAGACCACAGCGGAAGAAGTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030926.3-614s1c1
Sequence:CCGGCGAACTCAACACCACCATTGTCTCGAGACAATGGTGGTGTTGAGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030926.3-335s1c1
Sequence:CCGGGTTCGCCTCTGTCTACATCTACTCGAGTAGATGTAGACAGAGGCGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030926
ITM2C MISSION shRNA Lentiviral Transduction Particles
integral membrane protein 2C
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030926.3-597s1c1
Sequence:CCGGGACAAGTGCTATGTCATCGAACTCGAGTTCGATGACATAGCACTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030926.3-604s1c1
Sequence:CCGGGCTATGTCATCGAACTCAACACTCGAGTGTTGAGTTCGATGACATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030926.3-384s1c1
Sequence:CCGGCGAGATAACTTCTTCCGCTGTCTCGAGACAGCGGAAGAAGTTATCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030926.3-540s1c1
Sequence:CCGGGCAGACATCATCCATGACTTCCTCGAGGAAGTCATGGATGATGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030926.3-453s1c1
Sequence:CCGGGAGCTGGAAGAGGATGTGAAACTCGAGTTTCACATCCTCTTCCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030926.4-1009s1c1
Sequence:CCGGGCTTGTACTTTGGACGCGTTTCTCGAGAAACGCGTCCAAAGTACAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030926.3-387s1c1
Sequence:CCGGGATAACTTCTTCCGCTGTGGTCTCGAGACCACAGCGGAAGAAGTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030926.3-614s1c1
Sequence:CCGGCGAACTCAACACCACCATTGTCTCGAGACAATGGTGGTGTTGAGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030926.3-335s1c1
Sequence:CCGGGTTCGCCTCTGTCTACATCTACTCGAGTAGATGTAGACAGAGGCGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)