EMAIL THIS PAGE TO A FRIEND

ITPA

inosine triphosphatase (nucleoside triphosphate pyrophosphatase)

72 Gene Product Result for
Synonyms: C20orf37 HLC14-06-P dJ794I6.3
Gene ID:
Human(3704) Summary: This gene encodes an inosine triphosphate pyrophosphohydrolase. The encoded protein hydrolyzes inosine triphosphate and deoxyinosine triphosphate to the monophosphate nucleotide and diphosphate. This protein, which is a member of the HAM1 NTPase protein family, is found in the cytoplasm and acts as a homodimer. Defects in the encoded protein can result in inosine triphosphate pyrophosphorylase deficiency which causes an accumulation of ITP in red blood cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
Mouse(16434) inosine triphosphatase (nucleoside triphosphate pyrophosphatase)
Rat(311422) inosine triphosphatase (nucleoside triphosphate pyrophosphatase)
Zebrafish(557834) inosine triphosphatase (nucleoside triphosphate pyrophosphatase)
chicken(424390) inosine triphosphatase (nucleoside triphosphate pyrophosphatase)
cow(613653) inosine triphosphatase (nucleoside triphosphate pyrophosphatase)
domestic cat(101094498) inosine triphosphatase (nucleoside triphosphate pyrophosphatase)
dog(609255) inosine triphosphatase (nucleoside triphosphate pyrophosphatase)
sheep(101121956) inosine triphosphatase (nucleoside triphosphate pyrophosphatase)
domestic guinea pig(100718887) inosine triphosphatase (nucleoside triphosphate pyrophosphatase)
naked mole-rat(101724609) inosine triphosphatase (nucleoside triphosphate pyrophosphatase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033453 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033453 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033453 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025922 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025922 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025922 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033453 Rosetta Predictions human pricing
NM_181493 Rosetta Predictions human pricing
NM_001107774 Rosetta Predictions rat pricing
NM_025922 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033453 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194983 predicted 598
2 SASI_Hs01_00194984 predicted 894
3 SASI_Hs01_00194985 predicted 704
4 SASI_Hs01_00194987 predicted 626
5 SASI_Hs01_00194988 predicted 471
6 SASI_Hs01_00194989 predicted 597
7 SASI_Hs01_00194990 predicted 468
8 SASI_Hs01_00194991 predicted 482
9 SASI_Hs01_00194992 predicted 829
10 SASI_Hs02_00361344 predicted 418
11 SASI_Hs01_00194986 predicted 715
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181493 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097648 predicted 547
2 SASI_Hs01_00097649 predicted 845
3 SASI_Hs01_00097650 predicted 651
4 SASI_Hs01_00097652 predicted 579
5 SASI_Hs01_00097653 predicted 418
6 SASI_Hs01_00097654 predicted 545
7 SASI_Hs01_00097655 predicted 423
8 SASI_Hs01_00097656 predicted 431
9 SASI_Hs01_00097657 predicted 780
10 SASI_Hs02_00370114 predicted 362
11 SASI_Hs01_00097651 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107774 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232135 predicted 596
2 SASI_Rn02_00232136 predicted 523
3 SASI_Rn02_00232137 predicted 274
4 SASI_Rn02_00232138 predicted 270
5 SASI_Rn02_00232139 predicted 208
6 SASI_Rn02_00232140 predicted 272
7 SASI_Rn02_00232141 predicted 521
8 SASI_Rn02_00232142 predicted 229
9 SASI_Rn02_00232143 predicted 394
10 SASI_Rn02_00232144 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025922 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082252 predicted 508
2 SASI_Mm01_00082253 predicted 242
3 SASI_Mm01_00082254 predicted 480
4 SASI_Mm01_00082255 predicted 514
5 SASI_Mm01_00082256 predicted 468
6 SASI_Mm01_00082257 predicted 481
7 SASI_Mm01_00082258 predicted 575
8 SASI_Mm01_00082259 predicted 243
9 SASI_Mm01_00082260 predicted 478
10 SASI_Mm01_00082261 predicted 577
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033453
VALIDATED
ITPA MISSION shRNA Bacterial Glycerol Stock
inosine triphosphatase (nucleoside triphosphate pyrophosphatase)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358660    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_033453.2-976s21c1
Sequence:CCGGGAAAGGACCTTGGGTGGTAAACTCGAGTTTACCACCCAAGGTCCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033453.2-697s1c1
Sequence:CCGGGCAGGAGTACTTTGGCAGTTTCTCGAGAAACTGCCAAAGTACTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_033453.2-284s1c1
Sequence:CCGGGAGCCGGATGAGATTTCCATACTCGAGTATGGAAATCTCATCCGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033453.2-613s1c1
Sequence:CCGGTGATGGATATGAGCAGACGTACTCGAGTACGTCTGCTCATATCCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_033453.2-225s1c1
Sequence:CCGGGAGATAAGTTTCCATGCACTTCTCGAGAAGTGCATGGAAACTTATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_033453.2-211s1c1
Sequence:CCGGCGTTCAGATTCTAGGAGATAACTCGAGTTATCTCCTAGAATCTGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_033453.2-409s21c1
Sequence:CCGGGTGGTTTCTGGAGAAGTTAAACTCGAGTTTAACTTCTCCAGAAACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_033453.2-462s21c1
Sequence:CCGGTCGAGGACAAGTCAGCCTATGCTCGAGCATAGGCTGACTTGTCCTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033453
VALIDATED
ITPA MISSION shRNA shRNA Plasmid DNA
inosine triphosphatase (nucleoside triphosphate pyrophosphatase)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358660    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_033453.2-976s21c1
Sequence:CCGGGAAAGGACCTTGGGTGGTAAACTCGAGTTTACCACCCAAGGTCCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033453.2-697s1c1
Sequence:CCGGGCAGGAGTACTTTGGCAGTTTCTCGAGAAACTGCCAAAGTACTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_033453.2-284s1c1
Sequence:CCGGGAGCCGGATGAGATTTCCATACTCGAGTATGGAAATCTCATCCGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033453.2-613s1c1
Sequence:CCGGTGATGGATATGAGCAGACGTACTCGAGTACGTCTGCTCATATCCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_033453.2-225s1c1
Sequence:CCGGGAGATAAGTTTCCATGCACTTCTCGAGAAGTGCATGGAAACTTATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_033453.2-211s1c1
Sequence:CCGGCGTTCAGATTCTAGGAGATAACTCGAGTTATCTCCTAGAATCTGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_033453.2-409s21c1
Sequence:CCGGGTGGTTTCTGGAGAAGTTAAACTCGAGTTTAACTTCTCCAGAAACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_033453.2-462s21c1
Sequence:CCGGTCGAGGACAAGTCAGCCTATGCTCGAGCATAGGCTGACTTGTCCTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033453
VALIDATED
ITPA MISSION shRNA Lentiviral Transduction Particles
inosine triphosphatase (nucleoside triphosphate pyrophosphatase)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358660    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_033453.2-976s21c1
Sequence:CCGGGAAAGGACCTTGGGTGGTAAACTCGAGTTTACCACCCAAGGTCCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033453.2-697s1c1
Sequence:CCGGGCAGGAGTACTTTGGCAGTTTCTCGAGAAACTGCCAAAGTACTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_033453.2-284s1c1
Sequence:CCGGGAGCCGGATGAGATTTCCATACTCGAGTATGGAAATCTCATCCGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033453.2-613s1c1
Sequence:CCGGTGATGGATATGAGCAGACGTACTCGAGTACGTCTGCTCATATCCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_033453.2-225s1c1
Sequence:CCGGGAGATAAGTTTCCATGCACTTCTCGAGAAGTGCATGGAAACTTATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_033453.2-211s1c1
Sequence:CCGGCGTTCAGATTCTAGGAGATAACTCGAGTTATCTCCTAGAATCTGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_033453.2-409s21c1
Sequence:CCGGGTGGTTTCTGGAGAAGTTAAACTCGAGTTTAACTTCTCCAGAAACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_033453.2-462s21c1
Sequence:CCGGTCGAGGACAAGTCAGCCTATGCTCGAGCATAGGCTGACTTGTCCTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025922
VALIDATED
ITPA MISSION shRNA Bacterial Glycerol Stock
inosine triphosphatase (nucleoside triphosphate pyrophosphatase)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025922.2-545s1c1
Sequence:CCGGGAACACCATTTCTCATCGGTTCTCGAGAACCGATGAGAAATGGTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025922.2-56s1c1
Sequence:CCGGGATCGTGTTTGTGACGGGAAACTCGAGTTTCCCGTCACAAACACGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025922.2-773s1c1
Sequence:CCGGGCCAGTTGATACTAAACTCTTCTCGAGAAGAGTTTAGTATCAACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025922.2-171s1c1
Sequence:CCGGGAACCGGATGAGATTTCCATACTCGAGTATGGAAATCTCATCCGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025922.2-501s1c1
Sequence:CCGGGATGGATATGAGCAAACGTATCTCGAGATACGTTTGCTCATATCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025922.2-501s21c1
Sequence:CCGGGATGGATATGAGCAAACGTATCTCGAGATACGTTTGCTCATATCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025922.2-171s21c1
Sequence:CCGGGAACCGGATGAGATTTCCATACTCGAGTATGGAAATCTCATCCGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025922.2-242s21c1
Sequence:CCGGAGATACCTGTCTGTGCTTTAACTCGAGTTAAAGCACAGACAGGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025922.2-101s21c1
Sequence:CCGGTCAGATTCTCGGAGATAATTTCTCGAGAAATTATCTCCGAGAATCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354067    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025922.2-773s21c1
Sequence:CCGGGCCAGTTGATACTAAACTCTTCTCGAGAAGAGTTTAGTATCAACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025922
VALIDATED
ITPA MISSION shRNA shRNA Plasmid DNA
inosine triphosphatase (nucleoside triphosphate pyrophosphatase)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025922.2-545s1c1
Sequence:CCGGGAACACCATTTCTCATCGGTTCTCGAGAACCGATGAGAAATGGTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025922.2-56s1c1
Sequence:CCGGGATCGTGTTTGTGACGGGAAACTCGAGTTTCCCGTCACAAACACGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025922.2-773s1c1
Sequence:CCGGGCCAGTTGATACTAAACTCTTCTCGAGAAGAGTTTAGTATCAACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025922.2-171s1c1
Sequence:CCGGGAACCGGATGAGATTTCCATACTCGAGTATGGAAATCTCATCCGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025922.2-501s1c1
Sequence:CCGGGATGGATATGAGCAAACGTATCTCGAGATACGTTTGCTCATATCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025922.2-501s21c1
Sequence:CCGGGATGGATATGAGCAAACGTATCTCGAGATACGTTTGCTCATATCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025922.2-171s21c1
Sequence:CCGGGAACCGGATGAGATTTCCATACTCGAGTATGGAAATCTCATCCGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025922.2-242s21c1
Sequence:CCGGAGATACCTGTCTGTGCTTTAACTCGAGTTAAAGCACAGACAGGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025922.2-101s21c1
Sequence:CCGGTCAGATTCTCGGAGATAATTTCTCGAGAAATTATCTCCGAGAATCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354067    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025922.2-773s21c1
Sequence:CCGGGCCAGTTGATACTAAACTCTTCTCGAGAAGAGTTTAGTATCAACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025922
VALIDATED
ITPA MISSION shRNA Lentiviral Transduction Particles
inosine triphosphatase (nucleoside triphosphate pyrophosphatase)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025922.2-545s1c1
Sequence:CCGGGAACACCATTTCTCATCGGTTCTCGAGAACCGATGAGAAATGGTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025922.2-56s1c1
Sequence:CCGGGATCGTGTTTGTGACGGGAAACTCGAGTTTCCCGTCACAAACACGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025922.2-773s1c1
Sequence:CCGGGCCAGTTGATACTAAACTCTTCTCGAGAAGAGTTTAGTATCAACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025922.2-171s1c1
Sequence:CCGGGAACCGGATGAGATTTCCATACTCGAGTATGGAAATCTCATCCGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025922.2-501s1c1
Sequence:CCGGGATGGATATGAGCAAACGTATCTCGAGATACGTTTGCTCATATCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025922.2-501s21c1
Sequence:CCGGGATGGATATGAGCAAACGTATCTCGAGATACGTTTGCTCATATCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025922.2-171s21c1
Sequence:CCGGGAACCGGATGAGATTTCCATACTCGAGTATGGAAATCTCATCCGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025922.2-242s21c1
Sequence:CCGGAGATACCTGTCTGTGCTTTAACTCGAGTTAAAGCACAGACAGGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025922.2-101s21c1
Sequence:CCGGTCAGATTCTCGGAGATAATTTCTCGAGAAATTATCTCCGAGAATCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354067    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025922.2-773s21c1
Sequence:CCGGGCCAGTTGATACTAAACTCTTCTCGAGAAGAGTTTAGTATCAACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)