EMAIL THIS PAGE TO A FRIEND

ITPK1

inositol-tetrakisphosphate 1-kinase

81 Gene Product Result for
Synonyms: ITRPK1
UniProtKB ID: Q13572, Q9BTL6, Q9H2E7
Gene ID:
Mouse(217837) inositol 1,3,4-triphosphate 5/6 kinase
Rat(500709) inositol-tetrakisphosphate 1-kinase
sheep(101115161) inositol-tetrakisphosphate 1-kinase
Domestic Rabbit(100345790) inositol-tetrakisphosphate 1-kinase
domestic guinea pig(100717610) inositol-tetrakisphosphate 1-kinase
naked mole-rat(101700462) inositol-tetrakisphosphate 1-kinase
Zebrafish(406290) inositol 1,3,4-triphosphate 5/6 kinase
cow(518488) inositol-tetrakisphosphate 1-kinase
domestic cat(101087672) inositol-tetrakisphosphate 1-kinase
dog(490591) inositol-tetrakisphosphate 1-kinase
chicken(423421) inositol-tetrakisphosphate 1-kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014216 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014216 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014216 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172584 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172584 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172584 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014216 siRNAs that have been validated in the lab human pricing
XM_001058872 Rosetta Predictions rat pricing
XM_576090 Rosetta Predictions rat pricing
NM_172584 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014216 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_WI_00000044 validated 314
1 SASI_WI_00000045 validated 3049
2 SASI_Hs01_00026217 predicted 1904
3 SASI_Hs01_00026218 predicted 1746
4 SASI_Hs01_00026220 predicted 279
5 SASI_Hs01_00026221 predicted 1733
6 SASI_Hs01_00026222 predicted 1800
7 SASI_Hs01_00026223 predicted 1075
8 SASI_Hs01_00026225 predicted 730
9 SASI_Hs01_00026226 predicted 1567
10 SASI_Hs02_00345238 predicted 1146
11 SASI_Hs02_00345239 predicted 598
12 SASI_Hs01_00026219 predicted 1760
13 SASI_Hs01_00026224 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058872 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00291123 predicted 75
2 SASI_Rn02_00291124 predicted 17
3 SASI_Rn02_00291125 predicted 42
4 SASI_Rn02_00291126 predicted 33
5 SASI_Rn02_00291127 predicted 48
6 SASI_Rn02_00291128 predicted 40
7 SASI_Rn02_00291129 predicted 122
8 SASI_Rn02_00291130 predicted 117
9 SASI_Rn02_00291131 predicted 93
10 SASI_Rn02_00291132 predicted 110
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576090 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404743 predicted 1355
2 SASI_Rn02_00404744 predicted 685
3 SASI_Rn02_00404745 predicted 1086
4 SASI_Rn02_00404746 predicted 322
5 SASI_Rn02_00404747 predicted 1479
6 SASI_Rn02_00404748 predicted 1317
7 SASI_Rn02_00404749 predicted 1523
8 SASI_Rn02_00404750 predicted 271
9 SASI_Rn02_00404751 predicted 1489
10 SASI_Rn02_00404752 predicted 1402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172584 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112940 predicted 353
2 SASI_Mm01_00112941 predicted 749
3 SASI_Mm01_00112942 predicted 878
4 SASI_Mm01_00112943 predicted 545
5 SASI_Mm01_00112945 predicted 414
6 SASI_Mm01_00112946 predicted 694
7 SASI_Mm01_00112947 predicted 610
8 SASI_Mm01_00112948 predicted 809
9 SASI_Mm01_00112949 predicted 642
10 SASI_Mm02_00344264 predicted 538
11 SASI_Mm01_00112944 predicted 551
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014216
VALIDATED
ITPK1 MISSION shRNA Bacterial Glycerol Stock
inositol-tetrakisphosphate 1-kinase
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014216.4-777s21c1
Sequence:CCGGGCACCAACTCTCACGAGATGGCTCGAGCCATCTCGTGAGAGTTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014216.4-970s21c1
Sequence:CCGGCATCTTCTTCAACAGCCACAACTCGAGTTGTGGCTGTTGAAGAAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014216.3-2163s1c1
Sequence:CCGGCCCAACACACGTCCCATTTAGCTCGAGCTAAATGGGACGTGTGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219827    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014216.3-1633s1c1
Sequence:CCGGCTCTGATGTCATGATCTAAATCTCGAGATTTAGATCATGACATCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014216.4-790s21c1
Sequence:CCGGCGAGATGGCTATCGTGTTCAACTCGAGTTGAACACGATAGCCATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014216.4-733s21c1
Sequence:CCGGCGGCTTGACTTTCCCATTCATCTCGAGATGAATGGGAAAGTCAAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014216.4-628s21c1
Sequence:CCGGCCGGAAGATTGAGGCCTACATCTCGAGATGTAGGCCTCAATCTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014216.3-741s1c1
Sequence:CCGGGCACCAACTCTCACGAGATGGCTCGAGCCATCTCGTGAGAGTTGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014216.3-803s1c1
Sequence:CCGGCCCTGCGTGGTCCAGAATTTCCTCGAGGAAATTCTGGACCACGCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014216.3-815s1c1
Sequence:CCGGCAGAATTTCATCAACCACAACCTCGAGGTTGTGGTTGATGAAATTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014216.3-697s1c1
Sequence:CCGGCGGCTTGACTTTCCCATTCATCTCGAGATGAATGGGAAAGTCAAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014216.3-754s1c1
Sequence:CCGGCGAGATGGCTATCGTGTTCAACTCGAGTTGAACACGATAGCCATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014216.3-934s1c1
Sequence:CCGGCATCTTCTTCAACAGCCACAACTCGAGTTGTGGCTGTTGAAGAAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014216.3-592s1c1
Sequence:CCGGCCGGAAGATTGAGGCCTACATCTCGAGATGTAGGCCTCAATCTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014216.3-1124s1c1
Sequence:CCGGCACGCCGTCATTGACATCAATCTCGAGATTGATGTCAATGACGGCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014216
VALIDATED
ITPK1 MISSION shRNA shRNA Plasmid DNA
inositol-tetrakisphosphate 1-kinase
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014216.4-777s21c1
Sequence:CCGGGCACCAACTCTCACGAGATGGCTCGAGCCATCTCGTGAGAGTTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014216.4-970s21c1
Sequence:CCGGCATCTTCTTCAACAGCCACAACTCGAGTTGTGGCTGTTGAAGAAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014216.3-2163s1c1
Sequence:CCGGCCCAACACACGTCCCATTTAGCTCGAGCTAAATGGGACGTGTGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219827    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014216.3-1633s1c1
Sequence:CCGGCTCTGATGTCATGATCTAAATCTCGAGATTTAGATCATGACATCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014216.4-790s21c1
Sequence:CCGGCGAGATGGCTATCGTGTTCAACTCGAGTTGAACACGATAGCCATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014216.4-733s21c1
Sequence:CCGGCGGCTTGACTTTCCCATTCATCTCGAGATGAATGGGAAAGTCAAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014216.4-628s21c1
Sequence:CCGGCCGGAAGATTGAGGCCTACATCTCGAGATGTAGGCCTCAATCTTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014216.3-741s1c1
Sequence:CCGGGCACCAACTCTCACGAGATGGCTCGAGCCATCTCGTGAGAGTTGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014216.3-803s1c1
Sequence:CCGGCCCTGCGTGGTCCAGAATTTCCTCGAGGAAATTCTGGACCACGCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014216.3-815s1c1
Sequence:CCGGCAGAATTTCATCAACCACAACCTCGAGGTTGTGGTTGATGAAATTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014216.3-697s1c1
Sequence:CCGGCGGCTTGACTTTCCCATTCATCTCGAGATGAATGGGAAAGTCAAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014216.3-754s1c1
Sequence:CCGGCGAGATGGCTATCGTGTTCAACTCGAGTTGAACACGATAGCCATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014216.3-934s1c1
Sequence:CCGGCATCTTCTTCAACAGCCACAACTCGAGTTGTGGCTGTTGAAGAAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014216.3-592s1c1
Sequence:CCGGCCGGAAGATTGAGGCCTACATCTCGAGATGTAGGCCTCAATCTTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014216.3-1124s1c1
Sequence:CCGGCACGCCGTCATTGACATCAATCTCGAGATTGATGTCAATGACGGCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014216
VALIDATED
ITPK1 MISSION shRNA Lentiviral Transduction Particles
inositol-tetrakisphosphate 1-kinase
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014216.4-777s21c1
Sequence:CCGGGCACCAACTCTCACGAGATGGCTCGAGCCATCTCGTGAGAGTTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014216.4-970s21c1
Sequence:CCGGCATCTTCTTCAACAGCCACAACTCGAGTTGTGGCTGTTGAAGAAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014216.3-2163s1c1
Sequence:CCGGCCCAACACACGTCCCATTTAGCTCGAGCTAAATGGGACGTGTGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219827    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014216.3-1633s1c1
Sequence:CCGGCTCTGATGTCATGATCTAAATCTCGAGATTTAGATCATGACATCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014216.4-790s21c1
Sequence:CCGGCGAGATGGCTATCGTGTTCAACTCGAGTTGAACACGATAGCCATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014216.4-733s21c1
Sequence:CCGGCGGCTTGACTTTCCCATTCATCTCGAGATGAATGGGAAAGTCAAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014216.4-628s21c1
Sequence:CCGGCCGGAAGATTGAGGCCTACATCTCGAGATGTAGGCCTCAATCTTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014216.3-741s1c1
Sequence:CCGGGCACCAACTCTCACGAGATGGCTCGAGCCATCTCGTGAGAGTTGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014216.3-803s1c1
Sequence:CCGGCCCTGCGTGGTCCAGAATTTCCTCGAGGAAATTCTGGACCACGCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014216.3-815s1c1
Sequence:CCGGCAGAATTTCATCAACCACAACCTCGAGGTTGTGGTTGATGAAATTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014216.3-697s1c1
Sequence:CCGGCGGCTTGACTTTCCCATTCATCTCGAGATGAATGGGAAAGTCAAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014216.3-754s1c1
Sequence:CCGGCGAGATGGCTATCGTGTTCAACTCGAGTTGAACACGATAGCCATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014216.3-934s1c1
Sequence:CCGGCATCTTCTTCAACAGCCACAACTCGAGTTGTGGCTGTTGAAGAAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014216.3-592s1c1
Sequence:CCGGCCGGAAGATTGAGGCCTACATCTCGAGATGTAGGCCTCAATCTTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014216.3-1124s1c1
Sequence:CCGGCACGCCGTCATTGACATCAATCTCGAGATTGATGTCAATGACGGCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172584
ITPK1 MISSION shRNA Bacterial Glycerol Stock
inositol-tetrakisphosphate 1-kinase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172584.1-381s1c1
Sequence:CCGGCTACGAACTTATCCGAAAGATCTCGAGATCTTTCGGATAAGTTCGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172584.1-924s1c1
Sequence:CCGGGCATGCAGTCATCGATGTCAACTCGAGTTGACATCGATGACTGCATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172584.1-535s1c1
Sequence:CCGGGCTCATGGAACCAACTCTCATCTCGAGATGAGAGTTGGTTCCATGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172584.1-105s1c1
Sequence:CCGGGAAAGTCAAGAAGCTCAATTTCTCGAGAAATTGAGCTTCTTGACTTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172584.1-615s1c1
Sequence:CCGGCCAGAACTTCATCAACCACAACTCGAGTTGTGGTTGATGAAGTTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172584
ITPK1 MISSION shRNA shRNA Plasmid DNA
inositol-tetrakisphosphate 1-kinase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172584.1-381s1c1
Sequence:CCGGCTACGAACTTATCCGAAAGATCTCGAGATCTTTCGGATAAGTTCGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172584.1-924s1c1
Sequence:CCGGGCATGCAGTCATCGATGTCAACTCGAGTTGACATCGATGACTGCATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172584.1-535s1c1
Sequence:CCGGGCTCATGGAACCAACTCTCATCTCGAGATGAGAGTTGGTTCCATGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172584.1-105s1c1
Sequence:CCGGGAAAGTCAAGAAGCTCAATTTCTCGAGAAATTGAGCTTCTTGACTTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172584.1-615s1c1
Sequence:CCGGCCAGAACTTCATCAACCACAACTCGAGTTGTGGTTGATGAAGTTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172584
ITPK1 MISSION shRNA Lentiviral Transduction Particles
inositol-tetrakisphosphate 1-kinase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172584.1-381s1c1
Sequence:CCGGCTACGAACTTATCCGAAAGATCTCGAGATCTTTCGGATAAGTTCGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172584.1-924s1c1
Sequence:CCGGGCATGCAGTCATCGATGTCAACTCGAGTTGACATCGATGACTGCATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172584.1-535s1c1
Sequence:CCGGGCTCATGGAACCAACTCTCATCTCGAGATGAGAGTTGGTTCCATGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172584.1-105s1c1
Sequence:CCGGGAAAGTCAAGAAGCTCAATTTCTCGAGAAATTGAGCTTCTTGACTTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172584.1-615s1c1
Sequence:CCGGCCAGAACTTCATCAACCACAACTCGAGTTGTGGTTGATGAAGTTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)