EMAIL THIS PAGE TO A FRIEND

ITPKA

inositol-trisphosphate 3-kinase A

76 Gene Product Result for
Synonyms: IP3-3KA IP3KA
UniProtKB ID: P23677, Q8TAN3
Gene ID:
Human(3706) Summary: Regulates inositol phosphate metabolism by phosphorylation of second messenger inositol 1,4,5-trisphosphate to Ins(1,3,4,5)P4. The activity of the inositol 1,4,5-trisphosphate 3-kinase is responsible for regulating the levels of a large number of inositol polyphosphates that are important in cellular signaling. Both calcium/calmodulin and protein phosphorylation mechanisms control its activity. It is also a substrate for the cyclic AMP-dependent protein kinase, calcium/calmodulin- dependent protein kinase II, and protein kinase C in vitro.[provided by RefSeq, Apr 2011]
Mouse(228550) inositol 1,4,5-trisphosphate 3-kinase A
Rat(81677) inositol-trisphosphate 3-kinase A
Zebrafish(368717) inositol 1,4,5-trisphosphate 3-kinase A
chicken(395694) inositol 1,4,5-trisphosphate 3-kinase A
cow(615813) inositol-trisphosphate 3-kinase A
domestic cat(101084366) inositol-trisphosphate 3-kinase A
dog(487507) inositol-trisphosphate 3-kinase A
domestic guinea pig(100733156) inositol-trisphosphate 3-kinase A
naked mole-rat(101698565) inositol-trisphosphate 3-kinase A
sheep(101115627) inositol-trisphosphate 3-kinase A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146125 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146125 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146125 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002220 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002220 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002220 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002220 Rosetta Predictions human pricing
NM_031045 Rosetta Predictions rat pricing
NM_146125 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002220 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010041 predicted 1059
2 SASI_Hs01_00010042 predicted 1106
3 SASI_Hs01_00010043 predicted 776
4 SASI_Hs01_00010044 predicted 782
5 SASI_Hs01_00010045 predicted 501
6 SASI_Hs01_00010046 predicted 538
7 SASI_Hs01_00010047 predicted 1072
8 SASI_Hs01_00010048 predicted 1043
9 SASI_Hs01_00010049 predicted 1162
10 SASI_Hs01_00010050 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031045 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072769 predicted 1090
2 SASI_Rn01_00072770 predicted 1403
3 SASI_Rn01_00072771 predicted 587
4 SASI_Rn01_00072772 predicted 1261
5 SASI_Rn01_00072773 predicted 562
6 SASI_Rn01_00072774 predicted 884
7 SASI_Rn01_00072775 predicted 538
8 SASI_Rn01_00072776 predicted 1123
9 SASI_Rn02_00264270 predicted 1049
10 SASI_Rn01_00072777 predicted 1546
11 SASI_Rn01_00072768 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146125 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146280 predicted 1143
2 SASI_Mm01_00146281 predicted 1258
3 SASI_Mm01_00146282 predicted 756
4 SASI_Mm01_00146283 predicted 587
5 SASI_Mm01_00146284 predicted 1019
6 SASI_Mm01_00146285 predicted 800
7 SASI_Mm01_00146286 predicted 959
8 SASI_Mm01_00146287 predicted 1049
9 SASI_Mm01_00146288 predicted 581
10 SASI_Mm01_00146289 predicted 263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146125
ITPKA MISSION shRNA Bacterial Glycerol Stock
inositol-trisphosphate 3-kinase A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146125.1-1037s1c1
Sequence:CCGGGCATCAAGAAAGCCGATGGATCTCGAGATCCATCGGCTTTCTTGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146125.1-1104s1c1
Sequence:CCGGCCGTGTCTTTGAGGAGTTCATCTCGAGATGAACTCCTCAAAGACACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146125.1-573s1c1
Sequence:CCGGGAGTCCTTTCAGAAAGCGCTACTCGAGTAGCGCTTTCTGAAAGGACTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146125.1-1377s1c1
Sequence:CCGGGCTGGACAATCTCATTGGCATCTCGAGATGCCAATGAGATTGTCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146125.1-976s1c1
Sequence:CCGGCGCTACATGCAATGGCGCGAACTCGAGTTCGCGCCATTGCATGTAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146125.2-1350s21c1
Sequence:CCGGCAACCGTGAGGACGGCTATTTCTCGAGAAATAGCCGTCCTCACGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146125.2-885s21c1
Sequence:CCGGGCTGCGGAAGGACATGTATAACTCGAGTTATACATGTCCTTCCGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146125.2-1618s21c1
Sequence:CCGGAGAGCTGAATGACACTAATTTCTCGAGAAATTAGTGTCATTCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146125
ITPKA MISSION shRNA shRNA Plasmid DNA
inositol-trisphosphate 3-kinase A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146125.1-1037s1c1
Sequence:CCGGGCATCAAGAAAGCCGATGGATCTCGAGATCCATCGGCTTTCTTGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146125.1-1104s1c1
Sequence:CCGGCCGTGTCTTTGAGGAGTTCATCTCGAGATGAACTCCTCAAAGACACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146125.1-573s1c1
Sequence:CCGGGAGTCCTTTCAGAAAGCGCTACTCGAGTAGCGCTTTCTGAAAGGACTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146125.1-1377s1c1
Sequence:CCGGGCTGGACAATCTCATTGGCATCTCGAGATGCCAATGAGATTGTCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146125.1-976s1c1
Sequence:CCGGCGCTACATGCAATGGCGCGAACTCGAGTTCGCGCCATTGCATGTAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146125.2-1350s21c1
Sequence:CCGGCAACCGTGAGGACGGCTATTTCTCGAGAAATAGCCGTCCTCACGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146125.2-885s21c1
Sequence:CCGGGCTGCGGAAGGACATGTATAACTCGAGTTATACATGTCCTTCCGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146125.2-1618s21c1
Sequence:CCGGAGAGCTGAATGACACTAATTTCTCGAGAAATTAGTGTCATTCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146125
ITPKA MISSION shRNA Lentiviral Transduction Particles
inositol-trisphosphate 3-kinase A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146125.1-1037s1c1
Sequence:CCGGGCATCAAGAAAGCCGATGGATCTCGAGATCCATCGGCTTTCTTGATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146125.1-1104s1c1
Sequence:CCGGCCGTGTCTTTGAGGAGTTCATCTCGAGATGAACTCCTCAAAGACACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146125.1-573s1c1
Sequence:CCGGGAGTCCTTTCAGAAAGCGCTACTCGAGTAGCGCTTTCTGAAAGGACTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146125.1-1377s1c1
Sequence:CCGGGCTGGACAATCTCATTGGCATCTCGAGATGCCAATGAGATTGTCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146125.1-976s1c1
Sequence:CCGGCGCTACATGCAATGGCGCGAACTCGAGTTCGCGCCATTGCATGTAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146125.2-1350s21c1
Sequence:CCGGCAACCGTGAGGACGGCTATTTCTCGAGAAATAGCCGTCCTCACGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146125.2-885s21c1
Sequence:CCGGGCTGCGGAAGGACATGTATAACTCGAGTTATACATGTCCTTCCGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146125.2-1618s21c1
Sequence:CCGGAGAGCTGAATGACACTAATTTCTCGAGAAATTAGTGTCATTCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002220
ITPKA MISSION shRNA Bacterial Glycerol Stock
inositol-trisphosphate 3-kinase A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002220.1-539s1c1
Sequence:CCGGGCCGGTCATAAGCCCTTTCAACTCGAGTTGAAAGGGCTTATGACCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002220.1-529s1c1
Sequence:CCGGTGGTCAATCTGCCGGTCATAACTCGAGTTATGACCGGCAGATTGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002220.1-1076s1c1
Sequence:CCGGGCTTCGCGTCTTTGAAGAGTTCTCGAGAACTCTTCAAAGACGCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002220.1-783s1c1
Sequence:CCGGCCTTGTGTGCTCGACTGCAAACTCGAGTTTGCAGTCGAGCACACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002220.1-1089s1c1
Sequence:CCGGGAAGAGTTTGTGCAAGGAGATCTCGAGATCTCCTTGCACAAACTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002220.1-864s1c1
Sequence:CCGGCGGAAGGACATGTACAAGAAACTCGAGTTTCTTGTACATGTCCTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199814    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002220.1-1420s1c1
Sequence:CCGGGCCGCTCACCTGACATGTGGACTCGAGTCCACATGTCAGGTGAGCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002220.1-368s1c1
Sequence:CCGGCCTTTCCACCTCGTCGGTCTCCTCGAGGAGACCGACGAGGTGGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002220.1-808s1c1
Sequence:CCGGGCGTCAGGACTTACCTAGAGGCTCGAGCCTCTAGGTAAGTCCTGACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002220
ITPKA MISSION shRNA shRNA Plasmid DNA
inositol-trisphosphate 3-kinase A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002220.1-539s1c1
Sequence:CCGGGCCGGTCATAAGCCCTTTCAACTCGAGTTGAAAGGGCTTATGACCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002220.1-529s1c1
Sequence:CCGGTGGTCAATCTGCCGGTCATAACTCGAGTTATGACCGGCAGATTGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002220.1-1076s1c1
Sequence:CCGGGCTTCGCGTCTTTGAAGAGTTCTCGAGAACTCTTCAAAGACGCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002220.1-783s1c1
Sequence:CCGGCCTTGTGTGCTCGACTGCAAACTCGAGTTTGCAGTCGAGCACACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002220.1-1089s1c1
Sequence:CCGGGAAGAGTTTGTGCAAGGAGATCTCGAGATCTCCTTGCACAAACTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002220.1-864s1c1
Sequence:CCGGCGGAAGGACATGTACAAGAAACTCGAGTTTCTTGTACATGTCCTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199814    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002220.1-1420s1c1
Sequence:CCGGGCCGCTCACCTGACATGTGGACTCGAGTCCACATGTCAGGTGAGCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002220.1-368s1c1
Sequence:CCGGCCTTTCCACCTCGTCGGTCTCCTCGAGGAGACCGACGAGGTGGAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002220.1-808s1c1
Sequence:CCGGGCGTCAGGACTTACCTAGAGGCTCGAGCCTCTAGGTAAGTCCTGACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002220
ITPKA MISSION shRNA Lentiviral Transduction Particles
inositol-trisphosphate 3-kinase A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002220.1-539s1c1
Sequence:CCGGGCCGGTCATAAGCCCTTTCAACTCGAGTTGAAAGGGCTTATGACCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002220.1-529s1c1
Sequence:CCGGTGGTCAATCTGCCGGTCATAACTCGAGTTATGACCGGCAGATTGACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002220.1-1076s1c1
Sequence:CCGGGCTTCGCGTCTTTGAAGAGTTCTCGAGAACTCTTCAAAGACGCGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002220.1-783s1c1
Sequence:CCGGCCTTGTGTGCTCGACTGCAAACTCGAGTTTGCAGTCGAGCACACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002220.1-1089s1c1
Sequence:CCGGGAAGAGTTTGTGCAAGGAGATCTCGAGATCTCCTTGCACAAACTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002220.1-864s1c1
Sequence:CCGGCGGAAGGACATGTACAAGAAACTCGAGTTTCTTGTACATGTCCTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199814    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002220.1-1420s1c1
Sequence:CCGGGCCGCTCACCTGACATGTGGACTCGAGTCCACATGTCAGGTGAGCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002220.1-368s1c1
Sequence:CCGGCCTTTCCACCTCGTCGGTCTCCTCGAGGAGACCGACGAGGTGGAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002220.1-808s1c1
Sequence:CCGGGCGTCAGGACTTACCTAGAGGCTCGAGCCTCTAGGTAAGTCCTGACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)