EMAIL THIS PAGE TO A FRIEND

ITPKB

inositol-trisphosphate 3-kinase B

101 Gene Product Result for
Synonyms: IP3-3KB IP3K IP3K-B IP3KB PIG37
UniProtKB ID: P27987, Q5VWL9, Q5VWM0, Q96BZ2, Q96JS1, Q9UH47
Gene ID:
Human(3707) Summary: The protein encoded by this protein regulates inositol phosphate metabolism by phosphorylation of second messenger inositol 1,4,5-trisphosphate to Ins(1,3,4,5)P4. The activity of this encoded protein is responsible for regulating the levels of a large number of inositol polyphosphates that are important in cellular signaling. Both calcium/calmodulin and protein phosphorylation mechanisms control its activity. [provided by RefSeq, Jul 2008]
Mouse(320404) inositol 1,4,5-trisphosphate 3-kinase B
Rat(54260) inositol-trisphosphate 3-kinase B
sheep(101113512) inositol-trisphosphate 3-kinase B
domestic guinea pig(101787457) inositol-trisphosphate 3-kinase B
naked mole-rat(101702375) inositol-trisphosphate 3-kinase B
Zebrafish(563019) inositol-trisphosphate 3-kinase B
chicken(416743) inositol-trisphosphate 3-kinase B
domestic cat(101087547) inositol-trisphosphate 3-kinase B
dog(490383) inositol-trisphosphate 3-kinase B
cow(540877) inositol-trisphosphate 3-kinase B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002221 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002221 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002221 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081175 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081175 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081175 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_205854 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_205854 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_205854 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002221 Rosetta Predictions human pricing
NM_019312 Rosetta Predictions rat pricing
NM_001081175 Rosetta Predictions mouse pricing
XM_205854 Rosetta Predictions mouse pricing
XM_900404 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002221 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167866 predicted 1723
2 SASI_Hs01_00167867 predicted 1435
3 SASI_Hs01_00167868 predicted 2926
4 SASI_Hs01_00167869 predicted 2612
5 SASI_Hs02_00333447 predicted 2548
6 SASI_Hs01_00167870 predicted 2576
7 SASI_Hs01_00167871 predicted 701
8 SASI_Hs01_00167872 predicted 2209
9 SASI_Hs01_00167875 predicted 2098
10 SASI_Hs02_00333448 predicted 1233
11 SASI_Hs01_00167873 predicted 1156
12 SASI_Hs01_00167874 predicted 2625
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019312 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044147 predicted 1878
2 SASI_Rn01_00044148 predicted 1430
3 SASI_Rn02_00262278 predicted 1255
4 SASI_Rn01_00044150 predicted 1904
5 SASI_Rn01_00044151 predicted 1502
6 SASI_Rn01_00044152 predicted 1359
7 SASI_Rn01_00044153 predicted 1368
8 SASI_Rn01_00044154 predicted 2076
9 SASI_Rn01_00044155 predicted 1372
10 SASI_Rn01_00044156 predicted 1353
11 SASI_Rn01_00044149 predicted 1343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081175 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295921 predicted 1382
2 SASI_Mm02_00295922 predicted 1268
3 SASI_Mm02_00295923 predicted 2539
4 SASI_Mm02_00295924 predicted 2951
5 SASI_Mm02_00295925 predicted 1520
6 SASI_Mm02_00295926 predicted 1241
7 SASI_Mm02_00295927 predicted 3032
8 SASI_Mm02_00295928 predicted 1268
9 SASI_Mm02_00295929 predicted 1263
10 SASI_Mm02_00295930 predicted 3002
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_205854 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00243178 predicted 1383
2 SASI_Mm01_00243179 predicted 1275
3 SASI_Mm01_00243180 predicted 2544
4 SASI_Mm01_00243181 predicted 2952
5 SASI_Mm01_00243182 predicted 1251
6 SASI_Mm01_00243183 predicted 3036
7 SASI_Mm01_00243184 predicted 1273
8 SASI_Mm01_00243185 predicted 1266
9 SASI_Mm01_00243186 predicted 3002
10 SASI_Mm01_00243187 predicted 1445
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900404 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215962 predicted 1379
2 SASI_Mm01_00215963 predicted 2660
3 SASI_Mm01_00215964 predicted 2593
4 SASI_Mm01_00215965 predicted 1153
5 SASI_Mm01_00215966 predicted 2656
6 SASI_Mm01_00215967 predicted 1270
7 SASI_Mm01_00215968 predicted 2647
8 SASI_Mm01_00215969 predicted 2525
9 SASI_Mm01_00215970 predicted 1438
10 SASI_Mm01_00215971 predicted 1279
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002221
VALIDATED
ITPKB MISSION shRNA Bacterial Glycerol Stock
inositol-trisphosphate 3-kinase B
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002221.3-771s21c1
Sequence:CCGGACCAGAAAGTGGGCATGTTTGCTCGAGCAAACATGCCCACTTTCTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002221.3-2883s21c1
Sequence:CCGGATAACATCCTGATCGCCTATCCTCGAGGATAGGCGATCAGGATGTTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002221.3-3288s21c1
Sequence:CCGGACTGCACTACAAGACACTTTGCTCGAGCAAAGTGTCTTGTAGTGCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002221.3-2952s21c1
Sequence:CCGGTCAAGTGCCACGAGGTCATTGCTCGAGCAATGACCTCGTGGCACTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002221.3-1524s21c1
Sequence:CCGGAGACGACTGTGAGCGTGCAAACTCGAGTTTGCACGCTCACAGTCGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002221.2-2165s1c1
Sequence:CCGGCCTTCGTACCTGCCTACCATGCTCGAGCATGGTAGGCAGGTACGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197166    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002221.2-4915s1c1
Sequence:CCGGGCCTCTTATTGGCAATACTTGCTCGAGCAAGTATTGCCAATAAGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002221.2-1731s1c1
Sequence:CCGGCATACCTGCTGTCATCATTACCTCGAGGTAATGATGACAGCAGGTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_002221.2-1483s1c1
Sequence:CCGGGACGCTGCGAAAGATCTGAAACTCGAGTTTCAGATCTTTCGCAGCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002221.2-2509s1c1
Sequence:CCGGCGGGACTTCAAGAAGACCAAACTCGAGTTTGGTCTTCTTGAAGTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002221.2-717s1c1
Sequence:CCGGCTCGCAGGTGAAGAAAGGAATCTCGAGATTCCTTTCTTCACCTGCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002221.2-847s1c1
Sequence:CCGGACAGCTATGGAAATTGACAAACTCGAGTTTGTCAATTTCCATAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_002221.2-1970s1c1
Sequence:CCGGGCAAATCATGGAGGAAGATAACTCGAGTTATCTTCCTCCATGATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002221.2-2551s1c1
Sequence:CCGGGCCTTCAGAGAGTTCACTAAACTCGAGTTTAGTGAACTCTCTGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002221
VALIDATED
ITPKB MISSION shRNA shRNA Plasmid DNA
inositol-trisphosphate 3-kinase B
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002221.3-771s21c1
Sequence:CCGGACCAGAAAGTGGGCATGTTTGCTCGAGCAAACATGCCCACTTTCTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002221.3-2883s21c1
Sequence:CCGGATAACATCCTGATCGCCTATCCTCGAGGATAGGCGATCAGGATGTTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002221.3-3288s21c1
Sequence:CCGGACTGCACTACAAGACACTTTGCTCGAGCAAAGTGTCTTGTAGTGCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002221.3-2952s21c1
Sequence:CCGGTCAAGTGCCACGAGGTCATTGCTCGAGCAATGACCTCGTGGCACTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002221.3-1524s21c1
Sequence:CCGGAGACGACTGTGAGCGTGCAAACTCGAGTTTGCACGCTCACAGTCGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002221.2-2165s1c1
Sequence:CCGGCCTTCGTACCTGCCTACCATGCTCGAGCATGGTAGGCAGGTACGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197166    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002221.2-4915s1c1
Sequence:CCGGGCCTCTTATTGGCAATACTTGCTCGAGCAAGTATTGCCAATAAGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002221.2-1731s1c1
Sequence:CCGGCATACCTGCTGTCATCATTACCTCGAGGTAATGATGACAGCAGGTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_002221.2-1483s1c1
Sequence:CCGGGACGCTGCGAAAGATCTGAAACTCGAGTTTCAGATCTTTCGCAGCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002221.2-2509s1c1
Sequence:CCGGCGGGACTTCAAGAAGACCAAACTCGAGTTTGGTCTTCTTGAAGTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002221.2-717s1c1
Sequence:CCGGCTCGCAGGTGAAGAAAGGAATCTCGAGATTCCTTTCTTCACCTGCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002221.2-847s1c1
Sequence:CCGGACAGCTATGGAAATTGACAAACTCGAGTTTGTCAATTTCCATAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_002221.2-1970s1c1
Sequence:CCGGGCAAATCATGGAGGAAGATAACTCGAGTTATCTTCCTCCATGATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002221.2-2551s1c1
Sequence:CCGGGCCTTCAGAGAGTTCACTAAACTCGAGTTTAGTGAACTCTCTGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002221
VALIDATED
ITPKB MISSION shRNA Lentiviral Transduction Particles
inositol-trisphosphate 3-kinase B
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002221.3-771s21c1
Sequence:CCGGACCAGAAAGTGGGCATGTTTGCTCGAGCAAACATGCCCACTTTCTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002221.3-2883s21c1
Sequence:CCGGATAACATCCTGATCGCCTATCCTCGAGGATAGGCGATCAGGATGTTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002221.3-3288s21c1
Sequence:CCGGACTGCACTACAAGACACTTTGCTCGAGCAAAGTGTCTTGTAGTGCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002221.3-2952s21c1
Sequence:CCGGTCAAGTGCCACGAGGTCATTGCTCGAGCAATGACCTCGTGGCACTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002221.3-1524s21c1
Sequence:CCGGAGACGACTGTGAGCGTGCAAACTCGAGTTTGCACGCTCACAGTCGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002221.2-2165s1c1
Sequence:CCGGCCTTCGTACCTGCCTACCATGCTCGAGCATGGTAGGCAGGTACGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197166    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002221.2-4915s1c1
Sequence:CCGGGCCTCTTATTGGCAATACTTGCTCGAGCAAGTATTGCCAATAAGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002221.2-1731s1c1
Sequence:CCGGCATACCTGCTGTCATCATTACCTCGAGGTAATGATGACAGCAGGTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_002221.2-1483s1c1
Sequence:CCGGGACGCTGCGAAAGATCTGAAACTCGAGTTTCAGATCTTTCGCAGCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002221.2-2509s1c1
Sequence:CCGGCGGGACTTCAAGAAGACCAAACTCGAGTTTGGTCTTCTTGAAGTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002221.2-717s1c1
Sequence:CCGGCTCGCAGGTGAAGAAAGGAATCTCGAGATTCCTTTCTTCACCTGCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002221.2-847s1c1
Sequence:CCGGACAGCTATGGAAATTGACAAACTCGAGTTTGTCAATTTCCATAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_002221.2-1970s1c1
Sequence:CCGGGCAAATCATGGAGGAAGATAACTCGAGTTATCTTCCTCCATGATTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002221.2-2551s1c1
Sequence:CCGGGCCTTCAGAGAGTTCACTAAACTCGAGTTTAGTGAACTCTCTGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081175
VALIDATED
ITPKB MISSION shRNA Bacterial Glycerol Stock
inositol-trisphosphate 3-kinase B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321686    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081175.1-3646s21c1
Sequence:CCGGTGTGATCCCTGGTTGCCTAAACTCGAGTTTAGGCAACCAGGGATCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081175.1-2306s21c1
Sequence:CCGGCACTGGCTTCTCCTCTTCTTACTCGAGTAAGAAGAGGAGAAGCCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081175.1-1268s21c1
Sequence:CCGGTCCATCTACTTCCGTGAGAATCTCGAGATTCTCACGGAAGTAGATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081175.1-1883s21c1
Sequence:CCGGAGACGTTCATTATGGCCGAATCTCGAGATTCGGCCATAATGAACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081175.1-3083s21c1
Sequence:CCGGCCTGGAAATCTCTCCCTTCTTCTCGAGAAGAAGGGAGAGATTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081175
VALIDATED
ITPKB MISSION shRNA shRNA Plasmid DNA
inositol-trisphosphate 3-kinase B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321686    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081175.1-3646s21c1
Sequence:CCGGTGTGATCCCTGGTTGCCTAAACTCGAGTTTAGGCAACCAGGGATCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081175.1-2306s21c1
Sequence:CCGGCACTGGCTTCTCCTCTTCTTACTCGAGTAAGAAGAGGAGAAGCCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081175.1-1268s21c1
Sequence:CCGGTCCATCTACTTCCGTGAGAATCTCGAGATTCTCACGGAAGTAGATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081175.1-1883s21c1
Sequence:CCGGAGACGTTCATTATGGCCGAATCTCGAGATTCGGCCATAATGAACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081175.1-3083s21c1
Sequence:CCGGCCTGGAAATCTCTCCCTTCTTCTCGAGAAGAAGGGAGAGATTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081175
VALIDATED
ITPKB MISSION shRNA Lentiviral Transduction Particles
inositol-trisphosphate 3-kinase B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321686    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081175.1-3646s21c1
Sequence:CCGGTGTGATCCCTGGTTGCCTAAACTCGAGTTTAGGCAACCAGGGATCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081175.1-2306s21c1
Sequence:CCGGCACTGGCTTCTCCTCTTCTTACTCGAGTAAGAAGAGGAGAAGCCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081175.1-1268s21c1
Sequence:CCGGTCCATCTACTTCCGTGAGAATCTCGAGATTCTCACGGAAGTAGATGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081175.1-1883s21c1
Sequence:CCGGAGACGTTCATTATGGCCGAATCTCGAGATTCGGCCATAATGAACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081175.1-3083s21c1
Sequence:CCGGCCTGGAAATCTCTCCCTTCTTCTCGAGAAGAAGGGAGAGATTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_205854
VALIDATED
ITPKB MISSION shRNA Bacterial Glycerol Stock
inositol-trisphosphate 3-kinase B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_205854.3-2580s1c1
Sequence:CCGGCCTGGAAATCTCTCCCTTCTTCTCGAGAAGAAGGGAGAGATTTCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_205854.3-2529s1c1
Sequence:CCGGCCAGAACATCTTGATCGCCTACTCGAGTAGGCGATCAAGATGTTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205854.3-765s1c1
Sequence:CCGGTCCATCTACTTCCGTGAGAATCTCGAGATTCTCACGGAAGTAGATGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205854.3-1803s1c1
Sequence:CCGGCACTGGCTTCTCCTCTTCTTACTCGAGTAAGAAGAGGAGAAGCCAGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205854.3-1380s1c1
Sequence:CCGGAGACGTTCATTATGGCCGAATCTCGAGATTCGGCCATAATGAACGTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_205854
VALIDATED
ITPKB MISSION shRNA shRNA Plasmid DNA
inositol-trisphosphate 3-kinase B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_205854.3-2580s1c1
Sequence:CCGGCCTGGAAATCTCTCCCTTCTTCTCGAGAAGAAGGGAGAGATTTCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_205854.3-2529s1c1
Sequence:CCGGCCAGAACATCTTGATCGCCTACTCGAGTAGGCGATCAAGATGTTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205854.3-765s1c1
Sequence:CCGGTCCATCTACTTCCGTGAGAATCTCGAGATTCTCACGGAAGTAGATGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205854.3-1803s1c1
Sequence:CCGGCACTGGCTTCTCCTCTTCTTACTCGAGTAAGAAGAGGAGAAGCCAGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205854.3-1380s1c1
Sequence:CCGGAGACGTTCATTATGGCCGAATCTCGAGATTCGGCCATAATGAACGTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_205854
VALIDATED
ITPKB MISSION shRNA Lentiviral Transduction Particles
inositol-trisphosphate 3-kinase B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_205854.3-2580s1c1
Sequence:CCGGCCTGGAAATCTCTCCCTTCTTCTCGAGAAGAAGGGAGAGATTTCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_205854.3-2529s1c1
Sequence:CCGGCCAGAACATCTTGATCGCCTACTCGAGTAGGCGATCAAGATGTTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205854.3-765s1c1
Sequence:CCGGTCCATCTACTTCCGTGAGAATCTCGAGATTCTCACGGAAGTAGATGGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205854.3-1803s1c1
Sequence:CCGGCACTGGCTTCTCCTCTTCTTACTCGAGTAAGAAGAGGAGAAGCCAGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205854.3-1380s1c1
Sequence:CCGGAGACGTTCATTATGGCCGAATCTCGAGATTCGGCCATAATGAACGTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)