EMAIL THIS PAGE TO A FRIEND

ITPKC

inositol-trisphosphate 3-kinase C

61 Gene Product Result for
Synonyms: IP3-3KC IP3KC
UniProtKB ID: Q96DU7, Q9UE25, Q9Y475
Gene ID:
Human(80271) Summary: This gene encodes a member of the inositol 1,4,5-trisphosphate [Ins(1,4,5)P(3)]
Mouse(233011) inositol 1,4,5-trisphosphate 3-kinase C
Rat(308451) inositol-trisphosphate 3-kinase C
sheep(101120515) inositol-trisphosphate 3-kinase C
Domestic Rabbit(100354575) inositol-trisphosphate 3-kinase C
domestic guinea pig(100725789) inositol-trisphosphate 3-kinase C
naked mole-rat(101703054) inositol-trisphosphate 3-kinase C
cow(534051) inositol-trisphosphate 3-kinase C
Horse(100064775) inositol-trisphosphate 3-kinase C
domestic cat(101088202) inositol-trisphosphate 3-kinase C
dog(612489) inositol-trisphosphate 3-kinase C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181593 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181593 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181593 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025194 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025194 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025194 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025194 Rosetta Predictions human pricing
NM_178094 Rosetta Predictions rat pricing
NM_181593 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025194 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153676 predicted 601
2 SASI_Hs01_00153677 predicted 1424
3 SASI_Hs01_00153678 predicted 1653
4 SASI_Hs01_00153679 predicted 587
5 SASI_Hs01_00153680 predicted 1194
6 SASI_Hs01_00153682 predicted 1392
7 SASI_Hs01_00153683 predicted 1936
8 SASI_Hs01_00153684 predicted 783
9 SASI_Hs01_00153685 predicted 756
10 SASI_Hs02_00357969 predicted 1232
11 SASI_Hs01_00153681 predicted 961
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178094 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083341 predicted 1075
2 SASI_Rn01_00083342 predicted 1015
3 SASI_Rn01_00083343 predicted 696
4 SASI_Rn01_00083344 predicted 1450
5 SASI_Rn01_00083345 predicted 799
6 SASI_Rn01_00083346 predicted 918
7 SASI_Rn01_00083347 predicted 972
8 SASI_Rn01_00083348 predicted 1380
9 SASI_Rn01_00083349 predicted 769
10 SASI_Rn01_00083350 predicted 1991
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181593 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057077 predicted 2159
2 SASI_Mm01_00057078 predicted 979
3 SASI_Mm01_00057079 predicted 1010
4 SASI_Mm01_00057080 predicted 874
5 SASI_Mm01_00057081 predicted 1997
6 SASI_Mm01_00057082 predicted 1449
7 SASI_Mm01_00057083 predicted 2185
8 SASI_Mm01_00057084 predicted 826
9 SASI_Mm01_00057085 predicted 407
10 SASI_Mm01_00057086 predicted 797
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181593
ITPKC MISSION shRNA Bacterial Glycerol Stock
inositol-trisphosphate 3-kinase C
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181593.2-820s1c1
Sequence:CCGGGCTTCTGGATAGAGTCCCAAACTCGAGTTTGGGACTCTATCCAGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181593.2-745s1c1
Sequence:CCGGCACCAGAATCAAGTGCTGATACTCGAGTATCAGCACTTGATTCTGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181593.2-1491s1c1
Sequence:CCGGGCCTTCAACCAGATGGAAGATCTCGAGATCTTCCATCTGGTTGAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181593.2-1821s1c1
Sequence:CCGGCAGGTGACAAAGGTGTTAGAACTCGAGTTCTAACACCTTTGTCACCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181593.2-626s1c1
Sequence:CCGGCGAACTGGACAGATCCGATATCTCGAGATATCGGATCTGTCCAGTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181593.2-627s21c1
Sequence:CCGGGAACTGGACAGATCCGATATGCTCGAGCATATCGGATCTGTCCAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362120    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181593.2-2411s21c1
Sequence:CCGGCCAGAGGACCAGGCATCATTTCTCGAGAAATGATGCCTGGTCCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181593.2-671s21c1
Sequence:CCGGCAACAAGCCCAGGGTTGATAACTCGAGTTATCAACCCTGGGCTTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181593
ITPKC MISSION shRNA shRNA Plasmid DNA
inositol-trisphosphate 3-kinase C
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181593.2-820s1c1
Sequence:CCGGGCTTCTGGATAGAGTCCCAAACTCGAGTTTGGGACTCTATCCAGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181593.2-745s1c1
Sequence:CCGGCACCAGAATCAAGTGCTGATACTCGAGTATCAGCACTTGATTCTGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181593.2-1491s1c1
Sequence:CCGGGCCTTCAACCAGATGGAAGATCTCGAGATCTTCCATCTGGTTGAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181593.2-1821s1c1
Sequence:CCGGCAGGTGACAAAGGTGTTAGAACTCGAGTTCTAACACCTTTGTCACCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181593.2-626s1c1
Sequence:CCGGCGAACTGGACAGATCCGATATCTCGAGATATCGGATCTGTCCAGTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181593.2-627s21c1
Sequence:CCGGGAACTGGACAGATCCGATATGCTCGAGCATATCGGATCTGTCCAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362120    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181593.2-2411s21c1
Sequence:CCGGCCAGAGGACCAGGCATCATTTCTCGAGAAATGATGCCTGGTCCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181593.2-671s21c1
Sequence:CCGGCAACAAGCCCAGGGTTGATAACTCGAGTTATCAACCCTGGGCTTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181593
ITPKC MISSION shRNA Lentiviral Transduction Particles
inositol-trisphosphate 3-kinase C
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181593.2-820s1c1
Sequence:CCGGGCTTCTGGATAGAGTCCCAAACTCGAGTTTGGGACTCTATCCAGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181593.2-745s1c1
Sequence:CCGGCACCAGAATCAAGTGCTGATACTCGAGTATCAGCACTTGATTCTGGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181593.2-1491s1c1
Sequence:CCGGGCCTTCAACCAGATGGAAGATCTCGAGATCTTCCATCTGGTTGAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181593.2-1821s1c1
Sequence:CCGGCAGGTGACAAAGGTGTTAGAACTCGAGTTCTAACACCTTTGTCACCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181593.2-626s1c1
Sequence:CCGGCGAACTGGACAGATCCGATATCTCGAGATATCGGATCTGTCCAGTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181593.2-627s21c1
Sequence:CCGGGAACTGGACAGATCCGATATGCTCGAGCATATCGGATCTGTCCAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362120    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181593.2-2411s21c1
Sequence:CCGGCCAGAGGACCAGGCATCATTTCTCGAGAAATGATGCCTGGTCCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181593.2-671s21c1
Sequence:CCGGCAACAAGCCCAGGGTTGATAACTCGAGTTATCAACCCTGGGCTTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025194
VALIDATED
ITPKC MISSION shRNA Bacterial Glycerol Stock
inositol-trisphosphate 3-kinase C
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025194.2-946s21c1
Sequence:GTACCGGGAACCAGAGCCTGGAGAATTGCTCGAGCAATTCTCCAGGCTCTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_025194.2-830s1c1
Sequence:CCGGGTTTCCAAATACAACAGGATACTCGAGTATCCTGTTGTATTTGGAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025194.2-1551s1c1
Sequence:CCGGCCGGAAGGACATGTATGAGAACTCGAGTTCTCATACATGTCCTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025194.2-1233s1c1
Sequence:CCGGCTTTGTGGTCTCCTTCCGAAACTCGAGTTTCGGAAGGAGACCACAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_025194.2-695s1c1
Sequence:CCGGGCTCCTGGAAAGAATTGTATACTCGAGTATACAATTCTTTCCAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025194.2-1935s1c1
Sequence:CCGGCTGGATGATAGACTTCGGCAACTCGAGTTGCCGAAGTCTATCATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_025194.2-431s1c1
Sequence:CCGGCGACTTGTCTTTGGACGGAGACTCGAGTCTCCGTCCAAAGACAAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025194.2-2430s21c1
Sequence:GTACCGGGTGCCTGTGGACACATGAATCCTCGAGGATTCATGTGTCCACAGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025194.2-2091s21c1
Sequence:CCGGTCAGCCACCATCAGGTTAATTCTCGAGAATTAACCTGATGGTGGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025194.2-1385s21c1
Sequence:CCGGCTTTCGTGCCTGCCTACTATGCTCGAGCATAGTAGGCAGGCACGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025194.2-830s1c2
Sequence:CCGGGTTTCCAAATACAACAGGATACTCGAGTATCCTGTTGTATTTGGAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025194.2-2439s1c1
Sequence:CCGGGACACATGAATCACTTCTAACCTCGAGGTTAGAAGTGATTCATGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025194.2-1471s1c1
Sequence:CCGGCCCTCCATTATGGACTGCAAGCTCGAGCTTGCAGTCCATAATGGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_025194.2-1111s1c1
Sequence:CCGGGCCTCTTCTTTCGACGAGTCTCTCGAGAGACTCGTCGAAAGAAGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025194.2-750s21c1
Sequence:CCGGTCCCTGGACAGAGCCATATACCTCGAGGTATATGGCTCTGTCCAGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025194.2-1312s21c1
Sequence:CCGGGGTCGGATTCTGAAACGTTTCCTCGAGGAAACGTTTCAGAATCCGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025194.2-431s21c1
Sequence:CCGGCGACTTGTCTTTGGACGGAGACTCGAGTCTCCGTCCAAAGACAAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025194.2-2531s21c1
Sequence:GTACCGGCTCAGAGGGTCAGCATCATTGCTCGAGCAATGATGCTGACCCTCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025194
VALIDATED
ITPKC MISSION shRNA shRNA Plasmid DNA
inositol-trisphosphate 3-kinase C
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025194.2-946s21c1
Sequence:GTACCGGGAACCAGAGCCTGGAGAATTGCTCGAGCAATTCTCCAGGCTCTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_025194.2-830s1c1
Sequence:CCGGGTTTCCAAATACAACAGGATACTCGAGTATCCTGTTGTATTTGGAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025194.2-1551s1c1
Sequence:CCGGCCGGAAGGACATGTATGAGAACTCGAGTTCTCATACATGTCCTTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025194.2-1233s1c1
Sequence:CCGGCTTTGTGGTCTCCTTCCGAAACTCGAGTTTCGGAAGGAGACCACAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_025194.2-695s1c1
Sequence:CCGGGCTCCTGGAAAGAATTGTATACTCGAGTATACAATTCTTTCCAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025194.2-1935s1c1
Sequence:CCGGCTGGATGATAGACTTCGGCAACTCGAGTTGCCGAAGTCTATCATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_025194.2-431s1c1
Sequence:CCGGCGACTTGTCTTTGGACGGAGACTCGAGTCTCCGTCCAAAGACAAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025194.2-2430s21c1
Sequence:GTACCGGGTGCCTGTGGACACATGAATCCTCGAGGATTCATGTGTCCACAGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025194.2-2091s21c1
Sequence:CCGGTCAGCCACCATCAGGTTAATTCTCGAGAATTAACCTGATGGTGGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025194.2-1385s21c1
Sequence:CCGGCTTTCGTGCCTGCCTACTATGCTCGAGCATAGTAGGCAGGCACGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025194.2-830s1c2
Sequence:CCGGGTTTCCAAATACAACAGGATACTCGAGTATCCTGTTGTATTTGGAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025194.2-2439s1c1
Sequence:CCGGGACACATGAATCACTTCTAACCTCGAGGTTAGAAGTGATTCATGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025194.2-1471s1c1
Sequence:CCGGCCCTCCATTATGGACTGCAAGCTCGAGCTTGCAGTCCATAATGGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_025194.2-1111s1c1
Sequence:CCGGGCCTCTTCTTTCGACGAGTCTCTCGAGAGACTCGTCGAAAGAAGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025194.2-750s21c1
Sequence:CCGGTCCCTGGACAGAGCCATATACCTCGAGGTATATGGCTCTGTCCAGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025194.2-1312s21c1
Sequence:CCGGGGTCGGATTCTGAAACGTTTCCTCGAGGAAACGTTTCAGAATCCGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025194.2-431s21c1
Sequence:CCGGCGACTTGTCTTTGGACGGAGACTCGAGTCTCCGTCCAAAGACAAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025194.2-2531s21c1
Sequence:GTACCGGCTCAGAGGGTCAGCATCATTGCTCGAGCAATGATGCTGACCCTCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025194
VALIDATED
ITPKC MISSION shRNA Lentiviral Transduction Particles
inositol-trisphosphate 3-kinase C
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025194.2-946s21c1
Sequence:GTACCGGGAACCAGAGCCTGGAGAATTGCTCGAGCAATTCTCCAGGCTCTGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_025194.2-830s1c1
Sequence:CCGGGTTTCCAAATACAACAGGATACTCGAGTATCCTGTTGTATTTGGAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025194.2-1551s1c1
Sequence:CCGGCCGGAAGGACATGTATGAGAACTCGAGTTCTCATACATGTCCTTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025194.2-1233s1c1
Sequence:CCGGCTTTGTGGTCTCCTTCCGAAACTCGAGTTTCGGAAGGAGACCACAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_025194.2-695s1c1
Sequence:CCGGGCTCCTGGAAAGAATTGTATACTCGAGTATACAATTCTTTCCAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025194.2-1935s1c1
Sequence:CCGGCTGGATGATAGACTTCGGCAACTCGAGTTGCCGAAGTCTATCATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_025194.2-431s1c1
Sequence:CCGGCGACTTGTCTTTGGACGGAGACTCGAGTCTCCGTCCAAAGACAAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025194.2-2430s21c1
Sequence:GTACCGGGTGCCTGTGGACACATGAATCCTCGAGGATTCATGTGTCCACAGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025194.2-2091s21c1
Sequence:CCGGTCAGCCACCATCAGGTTAATTCTCGAGAATTAACCTGATGGTGGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025194.2-1385s21c1
Sequence:CCGGCTTTCGTGCCTGCCTACTATGCTCGAGCATAGTAGGCAGGCACGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025194.2-830s1c2
Sequence:CCGGGTTTCCAAATACAACAGGATACTCGAGTATCCTGTTGTATTTGGAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025194.2-2439s1c1
Sequence:CCGGGACACATGAATCACTTCTAACCTCGAGGTTAGAAGTGATTCATGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025194.2-1471s1c1
Sequence:CCGGCCCTCCATTATGGACTGCAAGCTCGAGCTTGCAGTCCATAATGGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_025194.2-1111s1c1
Sequence:CCGGGCCTCTTCTTTCGACGAGTCTCTCGAGAGACTCGTCGAAAGAAGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025194.2-750s21c1
Sequence:CCGGTCCCTGGACAGAGCCATATACCTCGAGGTATATGGCTCTGTCCAGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025194.2-1312s21c1
Sequence:CCGGGGTCGGATTCTGAAACGTTTCCTCGAGGAAACGTTTCAGAATCCGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025194.2-431s21c1
Sequence:CCGGCGACTTGTCTTTGGACGGAGACTCGAGTCTCCGTCCAAAGACAAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025194.2-2531s21c1
Sequence:GTACCGGCTCAGAGGGTCAGCATCATTGCTCGAGCAATGATGCTGACCCTCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)