EMAIL THIS PAGE TO A FRIEND

ITPR1

inositol 1,4,5-trisphosphate receptor, type 1

182 Gene Product Result for
Synonyms: INSP3R1 IP3R IP3R1 SCA15 SCA16 SCA29
UniProtKB ID: Q14643, E7EPX7, E9PDE9, Q14660, Q99897
Gene ID:
Human(3708) Summary: This gene encodes an intracellular receptor for inositol 1,4,5-trisphosphate. Upon stimulation by inositol 1,4,5-trisphosphate, this receptor mediates calcium release from the endoplasmic reticulum. Mutations in this gene cause spinocerebellar ataxia type 15, a disease associated with an heterogeneous group of cerebellar disorders. Multiple transcript variants have been identified for this gene. [provided by RefSeq, Nov 2009]
Mouse(16438) inositol 1,4,5-trisphosphate receptor 1
Rat(25262) inositol 1,4,5-trisphosphate receptor, type 1
Zebrafish(100149388) inositol 1,4,5-triphosphate receptor, type 1
chicken(395412) inositol 1,4,5-trisphosphate receptor, type 1
domestic cat(101100546) inositol 1,4,5-trisphosphate receptor, type 1
cow(317697) inositol 1,4,5-trisphosphate receptor, type 1
Horse(100052808) inositol 1,4,5-trisphosphate receptor, type 1
dog(476548) inositol 1,4,5-trisphosphate receptor, type 1
domestic guinea pig(100713023) inositol 1,4,5-trisphosphate receptor, type 1
naked mole-rat(101706047) inositol 1,4,5-trisphosphate receptor, type 1
sheep(101108864) inositol 1,4,5-trisphosphate receptor, type 1
sheep(100500722) inositol 1,4,5-trisphosphate receptor, type 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010585 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010585 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010585 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002222 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002222 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002222 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099952 Rosetta Predictions human pricing
NM_002222 Rosetta Predictions human pricing
NM_001007235 Rosetta Predictions rat pricing
NM_010585 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099952 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321614 predicted 2042
2 SASI_Hs02_00321615 predicted 8419
3 SASI_Hs02_00321616 predicted 6833
4 SASI_Hs02_00321617 predicted 962
5 SASI_Hs02_00321618 predicted 4097
6 SASI_Hs02_00321619 predicted 7272
7 SASI_Hs02_00321620 predicted 7673
8 SASI_Hs02_00321621 predicted 471
9 SASI_Hs02_00321622 predicted 4720
10 SASI_Hs02_00321623 predicted 7592
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002222 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333449 predicted 2005
2 SASI_Hs01_00233856 predicted 8374
3 SASI_Hs01_00233857 predicted 6785
4 SASI_Hs01_00233859 predicted 955
5 SASI_Hs01_00233860 predicted 4051
6 SASI_Hs01_00233862 predicted 7224
7 SASI_Hs01_00233863 predicted 7633
8 SASI_Hs01_00233865 predicted 477
9 SASI_Hs02_00333450 predicted 4675
10 SASI_Hs02_00333451 predicted 7538
11 SASI_Hs01_00233858 predicted 8034
12 SASI_Hs01_00233861 predicted 2053
13 SASI_Hs01_00233864 predicted 1021
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007235 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00122013 predicted 5831
2 SASI_Rn02_00198646 predicted 2449
3 SASI_Rn02_00198647 predicted 3850
4 SASI_Rn01_00122014 predicted 6997
5 SASI_Rn01_00122015 predicted 7787
6 SASI_Rn01_00122016 predicted 8517
7 SASI_Rn01_00122017 predicted 4723
8 SASI_Rn01_00122018 predicted 7671
9 SASI_Rn02_00198648 predicted 4069
10 SASI_Rn01_00122019 predicted 7744
11 SASI_Rn01_00122012 predicted 8199
12 SASI_Rn01_00122020 predicted 6995
13 SASI_Rn01_00122021 predicted 5783
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010585 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093612 predicted 3256
2 SASI_Mm02_00318874 predicted 1022
3 SASI_Mm01_00093613 predicted 1050
4 SASI_Mm01_00093614 predicted 7564
5 SASI_Mm01_00093615 predicted 7013
6 SASI_Mm02_00318875 predicted 1498
7 SASI_Mm01_00093618 predicted 2200
8 SASI_Mm01_00093619 predicted 8669
9 SASI_Mm01_00093620 predicted 7004
10 SASI_Mm01_00093621 predicted 7696
11 SASI_Mm01_00093616 predicted 3256
12 SASI_Mm01_00093617 predicted 2534
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010585
VALIDATED
ITPR1 MISSION shRNA Bacterial Glycerol Stock
inositol 1,4,5-trisphosphate receptor, type 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010585.3-7010s21c1
Sequence:CCGGGGAATCGAAACTTCGAATATACTCGAGTATATTCGAAGTTTCGATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010585.3-9512s21c1
Sequence:CCGGGCAGTAGGTAAGAAGTTATTACTCGAGTAATAACTTCTTACCTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010585.3-4598s21c1
Sequence:CCGGCGAGGTTAAGATCGCTTACATCTCGAGATGTAAGCGATCTTAACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010585.3-4257s21c1
Sequence:CCGGGGTCGAAACGTCCAGTATATCCTCGAGGATATACTGGACGTTTCGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010585.3-3345s21c1
Sequence:CCGGCGAGAGTTTGATGAAAGCAATCTCGAGATTGCTTTCATCAAACTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010585.2-9490s1c1
Sequence:CCGGGCAGTAGGTAAGAAGTTATTACTCGAGTAATAACTTCTTACCTACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010585.2-6818s1c1
Sequence:CCGGCGGCATAACAAAGAACTTCAACTCGAGTTGAAGTTCTTTGTTATGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010585.2-3323s1c1
Sequence:CCGGCGAGAGTTTGATGAAAGCAATCTCGAGATTGCTTTCATCAAACTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010585.2-4576s1c1
Sequence:CCGGCGAGGTTAAGATCGCTTACATCTCGAGATGTAAGCGATCTTAACCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010585.2-495s1c1
Sequence:CCGGGCCTCTTTAAGCTATGTCCTACTCGAGTAGGACATAGCTTAAAGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010585
VALIDATED
ITPR1 MISSION shRNA shRNA Plasmid DNA
inositol 1,4,5-trisphosphate receptor, type 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010585.3-7010s21c1
Sequence:CCGGGGAATCGAAACTTCGAATATACTCGAGTATATTCGAAGTTTCGATTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010585.3-9512s21c1
Sequence:CCGGGCAGTAGGTAAGAAGTTATTACTCGAGTAATAACTTCTTACCTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010585.3-4598s21c1
Sequence:CCGGCGAGGTTAAGATCGCTTACATCTCGAGATGTAAGCGATCTTAACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010585.3-4257s21c1
Sequence:CCGGGGTCGAAACGTCCAGTATATCCTCGAGGATATACTGGACGTTTCGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010585.3-3345s21c1
Sequence:CCGGCGAGAGTTTGATGAAAGCAATCTCGAGATTGCTTTCATCAAACTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010585.2-9490s1c1
Sequence:CCGGGCAGTAGGTAAGAAGTTATTACTCGAGTAATAACTTCTTACCTACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010585.2-6818s1c1
Sequence:CCGGCGGCATAACAAAGAACTTCAACTCGAGTTGAAGTTCTTTGTTATGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010585.2-3323s1c1
Sequence:CCGGCGAGAGTTTGATGAAAGCAATCTCGAGATTGCTTTCATCAAACTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010585.2-4576s1c1
Sequence:CCGGCGAGGTTAAGATCGCTTACATCTCGAGATGTAAGCGATCTTAACCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010585.2-495s1c1
Sequence:CCGGGCCTCTTTAAGCTATGTCCTACTCGAGTAGGACATAGCTTAAAGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010585
VALIDATED
ITPR1 MISSION shRNA Lentiviral Transduction Particles
inositol 1,4,5-trisphosphate receptor, type 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010585.3-7010s21c1
Sequence:CCGGGGAATCGAAACTTCGAATATACTCGAGTATATTCGAAGTTTCGATTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010585.3-9512s21c1
Sequence:CCGGGCAGTAGGTAAGAAGTTATTACTCGAGTAATAACTTCTTACCTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010585.3-4598s21c1
Sequence:CCGGCGAGGTTAAGATCGCTTACATCTCGAGATGTAAGCGATCTTAACCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010585.3-4257s21c1
Sequence:CCGGGGTCGAAACGTCCAGTATATCCTCGAGGATATACTGGACGTTTCGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010585.3-3345s21c1
Sequence:CCGGCGAGAGTTTGATGAAAGCAATCTCGAGATTGCTTTCATCAAACTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010585.2-9490s1c1
Sequence:CCGGGCAGTAGGTAAGAAGTTATTACTCGAGTAATAACTTCTTACCTACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010585.2-6818s1c1
Sequence:CCGGCGGCATAACAAAGAACTTCAACTCGAGTTGAAGTTCTTTGTTATGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010585.2-3323s1c1
Sequence:CCGGCGAGAGTTTGATGAAAGCAATCTCGAGATTGCTTTCATCAAACTCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010585.2-4576s1c1
Sequence:CCGGCGAGGTTAAGATCGCTTACATCTCGAGATGTAAGCGATCTTAACCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010585.2-495s1c1
Sequence:CCGGGCCTCTTTAAGCTATGTCCTACTCGAGTAGGACATAGCTTAAAGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002222
VALIDATED
ITPR1 MISSION shRNA Bacterial Glycerol Stock
inositol 1,4,5-trisphosphate receptor, type 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002222.4-2818s21c1
Sequence:CCGGGAGTTTGTGGAGGAGTATTTACTCGAGTAAATACTCCTCCACAAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002222.4-9254s21c1
Sequence:CCGGGTGTCATCTCCTGGGTAAATTCTCGAGAATTTACCCAGGAGATGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002222.4-400s21c1
Sequence:CCGGTACGCGGAGGGATCGACAAATCTCGAGATTTGTCGATCCCTCCGCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002222.4-1028s21c1
Sequence:CCGGGTGATAACAAAGACGACATATCTCGAGATATGTCGTCTTTGTTATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002222.4-4213s21c1
Sequence:CCGGGGTCGGAATGTCCAGTATATACTCGAGTATATACTGGACATTCCGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_002222.1-843s1c1
Sequence:CCGGGCAGCCATCAACTGGTAGATACTCGAGTATCTACCAGTTGATGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_002222.1-5160s1c1
Sequence:CCGGGCGGTTTCATTTGCAAGTTAACTCGAGTTAACTTGCAAATGAAACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_002222.1-671s1c1
Sequence:CCGGCCTGCTCTGTTGGAGAAGAATCTCGAGATTCTTCTCCAACAGAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_002222.1-6581s1c1
Sequence:CCGGGCTCGGCATAACAAAGAACTTCTCGAGAAGTTCTTTGTTATGCCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_002222.1-2045s1c1
Sequence:CCGGGCGGCAGAGATTGACACATTTCTCGAGAAATGTGTCAATCTCTGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002222
VALIDATED
ITPR1 MISSION shRNA shRNA Plasmid DNA
inositol 1,4,5-trisphosphate receptor, type 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002222.4-2818s21c1
Sequence:CCGGGAGTTTGTGGAGGAGTATTTACTCGAGTAAATACTCCTCCACAAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002222.4-9254s21c1
Sequence:CCGGGTGTCATCTCCTGGGTAAATTCTCGAGAATTTACCCAGGAGATGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002222.4-400s21c1
Sequence:CCGGTACGCGGAGGGATCGACAAATCTCGAGATTTGTCGATCCCTCCGCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002222.4-1028s21c1
Sequence:CCGGGTGATAACAAAGACGACATATCTCGAGATATGTCGTCTTTGTTATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002222.4-4213s21c1
Sequence:CCGGGGTCGGAATGTCCAGTATATACTCGAGTATATACTGGACATTCCGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_002222.1-843s1c1
Sequence:CCGGGCAGCCATCAACTGGTAGATACTCGAGTATCTACCAGTTGATGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_002222.1-5160s1c1
Sequence:CCGGGCGGTTTCATTTGCAAGTTAACTCGAGTTAACTTGCAAATGAAACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_002222.1-671s1c1
Sequence:CCGGCCTGCTCTGTTGGAGAAGAATCTCGAGATTCTTCTCCAACAGAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_002222.1-6581s1c1
Sequence:CCGGGCTCGGCATAACAAAGAACTTCTCGAGAAGTTCTTTGTTATGCCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_002222.1-2045s1c1
Sequence:CCGGGCGGCAGAGATTGACACATTTCTCGAGAAATGTGTCAATCTCTGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002222
VALIDATED
ITPR1 MISSION shRNA Lentiviral Transduction Particles
inositol 1,4,5-trisphosphate receptor, type 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002222.4-2818s21c1
Sequence:CCGGGAGTTTGTGGAGGAGTATTTACTCGAGTAAATACTCCTCCACAAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002222.4-9254s21c1
Sequence:CCGGGTGTCATCTCCTGGGTAAATTCTCGAGAATTTACCCAGGAGATGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002222.4-400s21c1
Sequence:CCGGTACGCGGAGGGATCGACAAATCTCGAGATTTGTCGATCCCTCCGCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002222.4-1028s21c1
Sequence:CCGGGTGATAACAAAGACGACATATCTCGAGATATGTCGTCTTTGTTATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002222.4-4213s21c1
Sequence:CCGGGGTCGGAATGTCCAGTATATACTCGAGTATATACTGGACATTCCGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_002222.1-843s1c1
Sequence:CCGGGCAGCCATCAACTGGTAGATACTCGAGTATCTACCAGTTGATGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_002222.1-5160s1c1
Sequence:CCGGGCGGTTTCATTTGCAAGTTAACTCGAGTTAACTTGCAAATGAAACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_002222.1-671s1c1
Sequence:CCGGCCTGCTCTGTTGGAGAAGAATCTCGAGATTCTTCTCCAACAGAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_002222.1-6581s1c1
Sequence:CCGGGCTCGGCATAACAAAGAACTTCTCGAGAAGTTCTTTGTTATGCCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_002222.1-2045s1c1
Sequence:CCGGGCGGCAGAGATTGACACATTTCTCGAGAAATGTGTCAATCTCTGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)