EMAIL THIS PAGE TO A FRIEND

ITPR2

inositol 1,4,5-trisphosphate receptor, type 2

168 Gene Product Result for
Synonyms: IP3R2
UniProtKB ID: Q14571, O94773
Gene ID:
Mouse(16439) inositol 1,4,5-triphosphate receptor 2
Rat(81678) inositol 1,4,5-trisphosphate receptor, type 2
Zebrafish(562585) inositol 1,4,5-triphosphate receptor, type 2
cow(281878) inositol 1,4,5-trisphosphate receptor, type 2
Horse(100064557) inositol 1,4,5-trisphosphate receptor, type 2
chicken(418212) inositol 1,4,5-trisphosphate receptor, type 2
dog(486628) inositol 1,4,5-trisphosphate receptor, type 2
sheep(101113317) inositol 1,4,5-trisphosphate receptor, type 2
Domestic Rabbit(100356806) inositol 1,4,5-trisphosphate receptor, type 2
domestic guinea pig(100717278) inositol 1,4,5-trisphosphate receptor, type 2
naked mole-rat(101716022) inositol 1,4,5-trisphosphate receptor, type 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010586 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010586 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010586 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002223 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002223 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002223 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002223 Rosetta Predictions human pricing
NM_031046 Rosetta Predictions rat pricing
NM_010586 Rosetta Predictions mouse pricing
NM_019923 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002223 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171999 predicted 6137
2 SASI_Hs01_00172000 predicted 6921
3 SASI_Hs01_00172001 predicted 6441
4 SASI_Hs01_00172002 predicted 3516
5 SASI_Hs01_00172003 predicted 1363
6 SASI_Hs01_00172004 predicted 7930
7 SASI_Hs01_00172005 predicted 7467
8 SASI_Hs01_00172006 predicted 7055
9 SASI_Hs01_00172007 predicted 7923
10 SASI_Hs01_00172008 predicted 1000
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031046 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264271 predicted 5719
2 SASI_Rn01_00110969 predicted 1153
3 SASI_Rn01_00110971 predicted 581
4 SASI_Rn01_00110972 predicted 8000
5 SASI_Rn01_00110973 predicted 2425
6 SASI_Rn01_00110974 predicted 6343
7 SASI_Rn01_00110975 predicted 6806
8 SASI_Rn02_00264272 predicted 8206
9 SASI_Rn01_00110976 predicted 3212
10 SASI_Rn01_00110978 predicted 7288
11 SASI_Rn01_00110970 predicted 6255
12 SASI_Rn01_00110977 predicted 1327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010586 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047127 predicted 5521
2 SASI_Mm02_00318876 predicted 5600
3 SASI_Mm01_00047128 predicted 5183
4 SASI_Mm01_00047129 predicted 7698
5 SASI_Mm02_00318877 predicted 6502
6 SASI_Mm01_00047131 predicted 6983
7 SASI_Mm01_00047133 predicted 5511
8 SASI_Mm01_00047134 predicted 5392
9 SASI_Mm02_00318878 predicted 4341
10 SASI_Mm02_00318879 predicted 1648
11 SASI_Mm01_00047125 predicted 4519
12 SASI_Mm01_00047126 predicted 7469
13 SASI_Mm01_00047130 predicted 5143
14 SASI_Mm01_00047132 predicted 2900
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019923 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136135 predicted 5624
2 SASI_Mm02_00325200 predicted 5699
3 SASI_Mm01_00136136 predicted 5277
4 SASI_Mm01_00136137 predicted 7801
5 SASI_Mm02_00325201 predicted 6594
6 SASI_Mm01_00136139 predicted 7082
7 SASI_Mm01_00136141 predicted 5614
8 SASI_Mm01_00136142 predicted 5491
9 SASI_Mm02_00325202 predicted 4448
10 SASI_Mm02_00325203 predicted 1748
11 SASI_Mm01_00136133 predicted 4620
12 SASI_Mm01_00136134 predicted 7573
13 SASI_Mm01_00136138 predicted 5237
14 SASI_Mm01_00136140 predicted 3005
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010586
VALIDATED
ITPR2 MISSION shRNA Bacterial Glycerol Stock
inositol 1,4,5-trisphosphate receptor, type 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097134    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010586.1-8081s1c1
Sequence:CCGGCCTGCCTCATCACAGAGGGATCTCGAGATCCCTCTGTGATGAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010586.1-2357s1c1
Sequence:CCGGCCCACAAAGATCACGATTCATCTCGAGATGAATCGTGATCTTTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010586.1-236s1c1
Sequence:CCGGGCCCAGAAGCAATACTGGAAACTCGAGTTTCCAGTATTGCTTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010586.1-1816s1c1
Sequence:CCGGGCCGAGGTTTCTGGACTATTTCTCGAGAAATAGTCCAGAAACCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010586.1-3212s1c1
Sequence:CCGGGCCTTTAAACAGGTGCAGTTACTCGAGTAACTGCACCTGTTTAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010586.1-4580s21c1
Sequence:CCGGATTGCGATCCCAGTCGATTTGCTCGAGCAAATCGACTGGGATCGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010586.1-6814s21c1
Sequence:CCGGTGTCATGCTCAGATCGATATACTCGAGTATATCGATCTGAGCATGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010586.1-2537s21c1
Sequence:CCGGGCCCGGAACCTCATCTATTTCCTCGAGGAAATAGATGAGGTTCCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010586.1-2844s21c1
Sequence:CCGGAGCTGAAGGTTATCGAGATTTCTCGAGAAATCTCGATAACCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010586.1-8059s21c1
Sequence:CCGGGTGACCAGCCTTTCATCGGATCTCGAGATCCGATGAAAGGCTGGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010586
VALIDATED
ITPR2 MISSION shRNA shRNA Plasmid DNA
inositol 1,4,5-trisphosphate receptor, type 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097134    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010586.1-8081s1c1
Sequence:CCGGCCTGCCTCATCACAGAGGGATCTCGAGATCCCTCTGTGATGAGGCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000097135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010586.1-2357s1c1
Sequence:CCGGCCCACAAAGATCACGATTCATCTCGAGATGAATCGTGATCTTTGTGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000097136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010586.1-236s1c1
Sequence:CCGGGCCCAGAAGCAATACTGGAAACTCGAGTTTCCAGTATTGCTTCTGGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000097137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010586.1-1816s1c1
Sequence:CCGGGCCGAGGTTTCTGGACTATTTCTCGAGAAATAGTCCAGAAACCTCGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000097138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010586.1-3212s1c1
Sequence:CCGGGCCTTTAAACAGGTGCAGTTACTCGAGTAACTGCACCTGTTTAAAGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000277567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010586.1-4580s21c1
Sequence:CCGGATTGCGATCCCAGTCGATTTGCTCGAGCAAATCGACTGGGATCGCAATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000277497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010586.1-6814s21c1
Sequence:CCGGTGTCATGCTCAGATCGATATACTCGAGTATATCGATCTGAGCATGACATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000277496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010586.1-2537s21c1
Sequence:CCGGGCCCGGAACCTCATCTATTTCCTCGAGGAAATAGATGAGGTTCCGGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000277566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010586.1-2844s21c1
Sequence:CCGGAGCTGAAGGTTATCGAGATTTCTCGAGAAATCTCGATAACCTTCAGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000285980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010586.1-8059s21c1
Sequence:CCGGGTGACCAGCCTTTCATCGGATCTCGAGATCCGATGAAAGGCTGGTCACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010586
VALIDATED
ITPR2 MISSION shRNA Lentiviral Transduction Particles
inositol 1,4,5-trisphosphate receptor, type 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097134    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010586.1-8081s1c1
Sequence:CCGGCCTGCCTCATCACAGAGGGATCTCGAGATCCCTCTGTGATGAGGCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010586.1-2357s1c1
Sequence:CCGGCCCACAAAGATCACGATTCATCTCGAGATGAATCGTGATCTTTGTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010586.1-236s1c1
Sequence:CCGGGCCCAGAAGCAATACTGGAAACTCGAGTTTCCAGTATTGCTTCTGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010586.1-1816s1c1
Sequence:CCGGGCCGAGGTTTCTGGACTATTTCTCGAGAAATAGTCCAGAAACCTCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010586.1-3212s1c1
Sequence:CCGGGCCTTTAAACAGGTGCAGTTACTCGAGTAACTGCACCTGTTTAAAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010586.1-4580s21c1
Sequence:CCGGATTGCGATCCCAGTCGATTTGCTCGAGCAAATCGACTGGGATCGCAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010586.1-6814s21c1
Sequence:CCGGTGTCATGCTCAGATCGATATACTCGAGTATATCGATCTGAGCATGACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010586.1-2537s21c1
Sequence:CCGGGCCCGGAACCTCATCTATTTCCTCGAGGAAATAGATGAGGTTCCGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010586.1-2844s21c1
Sequence:CCGGAGCTGAAGGTTATCGAGATTTCTCGAGAAATCTCGATAACCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010586.1-8059s21c1
Sequence:CCGGGTGACCAGCCTTTCATCGGATCTCGAGATCCGATGAAAGGCTGGTCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002223
ITPR2 MISSION shRNA Bacterial Glycerol Stock
inositol 1,4,5-trisphosphate receptor, type 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002223.1-1803s1c1
Sequence:CCGGGCACAATAACTCAGAATGAAACTCGAGTTTCATTCTGAGTTATTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002223.1-8246s1c1
Sequence:CCGGCCTGAAAGTTATGTGGCTCAACTCGAGTTGAGCCACATAACTTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002223.1-1364s1c1
Sequence:CCGGGCAGAGCTTAATCCTGATTATCTCGAGATAATCAGGATTAAGCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002223.1-7123s1c1
Sequence:CCGGCCTGGCTGTGTTCATCAATTTCTCGAGAAATTGATGAACACAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002223.2-4432s21c1
Sequence:CCGGGGTGAAGACGTGCTGATATTTCTCGAGAAATATCAGCACGTCTTCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002223.2-6071s21c1
Sequence:CCGGTGGATCCAGAAATAGACATTACTCGAGTAATGTCTATTTCTGGATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002223.2-5999s21c1
Sequence:CCGGAGGGAATGAAAGGGCAATTAACTCGAGTTAATTGCCCTTTCATTCCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002223.2-5077s21c1
Sequence:CCGGGATTTGGACAGCCAAGTTAATCTCGAGATTAACTTGGCTGTCCAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002223.2-7584s21c1
Sequence:CCGGACGAAATGGCCGCTCTATTATCTCGAGATAATAGAGCGGCCATTTCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002223.2-3720s21c1
Sequence:CCGGGTCTAATCAAGACGTAGATAACTCGAGTTATCTACGTCTTGATTAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002223
ITPR2 MISSION shRNA shRNA Plasmid DNA
inositol 1,4,5-trisphosphate receptor, type 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002223.1-1803s1c1
Sequence:CCGGGCACAATAACTCAGAATGAAACTCGAGTTTCATTCTGAGTTATTGTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002223.1-8246s1c1
Sequence:CCGGCCTGAAAGTTATGTGGCTCAACTCGAGTTGAGCCACATAACTTTCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002223.1-1364s1c1
Sequence:CCGGGCAGAGCTTAATCCTGATTATCTCGAGATAATCAGGATTAAGCTCTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002223.1-7123s1c1
Sequence:CCGGCCTGGCTGTGTTCATCAATTTCTCGAGAAATTGATGAACACAGCCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000431806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002223.2-4432s21c1
Sequence:CCGGGGTGAAGACGTGCTGATATTTCTCGAGAAATATCAGCACGTCTTCACCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000430331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002223.2-6071s21c1
Sequence:CCGGTGGATCCAGAAATAGACATTACTCGAGTAATGTCTATTTCTGGATCCATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000414372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002223.2-5999s21c1
Sequence:CCGGAGGGAATGAAAGGGCAATTAACTCGAGTTAATTGCCCTTTCATTCCCTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000421588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002223.2-5077s21c1
Sequence:CCGGGATTTGGACAGCCAAGTTAATCTCGAGATTAACTTGGCTGTCCAAATCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000421936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002223.2-7584s21c1
Sequence:CCGGACGAAATGGCCGCTCTATTATCTCGAGATAATAGAGCGGCCATTTCGTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000423300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002223.2-3720s21c1
Sequence:CCGGGTCTAATCAAGACGTAGATAACTCGAGTTATCTACGTCTTGATTAGACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002223
ITPR2 MISSION shRNA Lentiviral Transduction Particles
inositol 1,4,5-trisphosphate receptor, type 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002223.1-1803s1c1
Sequence:CCGGGCACAATAACTCAGAATGAAACTCGAGTTTCATTCTGAGTTATTGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002223.1-8246s1c1
Sequence:CCGGCCTGAAAGTTATGTGGCTCAACTCGAGTTGAGCCACATAACTTTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002223.1-1364s1c1
Sequence:CCGGGCAGAGCTTAATCCTGATTATCTCGAGATAATCAGGATTAAGCTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002223.1-7123s1c1
Sequence:CCGGCCTGGCTGTGTTCATCAATTTCTCGAGAAATTGATGAACACAGCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002223.2-4432s21c1
Sequence:CCGGGGTGAAGACGTGCTGATATTTCTCGAGAAATATCAGCACGTCTTCACCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002223.2-6071s21c1
Sequence:CCGGTGGATCCAGAAATAGACATTACTCGAGTAATGTCTATTTCTGGATCCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002223.2-5999s21c1
Sequence:CCGGAGGGAATGAAAGGGCAATTAACTCGAGTTAATTGCCCTTTCATTCCCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002223.2-5077s21c1
Sequence:CCGGGATTTGGACAGCCAAGTTAATCTCGAGATTAACTTGGCTGTCCAAATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002223.2-7584s21c1
Sequence:CCGGACGAAATGGCCGCTCTATTATCTCGAGATAATAGAGCGGCCATTTCGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002223.2-3720s21c1
Sequence:CCGGGTCTAATCAAGACGTAGATAACTCGAGTTATCTACGTCTTGATTAGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)