EMAIL THIS PAGE TO A FRIEND

ITPR3

inositol 1,4,5-trisphosphate receptor, type 3

56 Gene Product Result for
Synonyms: IP3R IP3R3
UniProtKB ID: Q14573, Q14649, Q5TAQ2
Gene ID:
Human(3710) Summary: This gene encodes a receptor for inositol 1,4,5-trisphosphate, a second messenger that mediates the release of intracellular calcium. The receptor contains a calcium channel at the C-terminus and the ligand-binding site at the N-terminus. Knockout studies in mice suggest that type 2 and type 3 inositol 1,4,5-trisphosphate receptors play a key role in exocrine secretion underlying energy metabolism and growth. [provided by RefSeq, Aug 2010]
Mouse(16440) inositol 1,4,5-triphosphate receptor 3
Rat(25679) inositol 1,4,5-trisphosphate receptor, type 3
domestic guinea pig(100729184) inositol 1,4,5-trisphosphate receptor, type 3
naked mole-rat(101706978) inositol 1,4,5-trisphosphate receptor, type 3
sheep(101118392) inositol 1,4,5-trisphosphate receptor, type 3
Zebrafish(794666) inositol 1,4,5-triphosphate receptor, type 3
cow(281879) inositol 1,4,5-trisphosphate receptor, type 3
Horse(100053019) inositol 1,4,5-trisphosphate receptor, type 3
domestic cat(101087993) inositol 1,4,5-trisphosphate receptor, type 3
dog(481746) inositol 1,4,5-trisphosphate receptor, type 3
chicken(419910) inositol 1,4,5-trisphosphate receptor, type 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080553 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080553 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080553 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002224 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002224 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002224 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU164061 MISSION® esiRNA esiRNA targeting mouse Itpr3 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002224 Rosetta Predictions human pricing
NM_013138 Rosetta Predictions rat pricing
NM_080553 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002224 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131615 predicted 801
2 SASI_Hs02_00333452 predicted 466
3 SASI_Hs01_00131617 predicted 6124
4 SASI_Hs01_00131618 predicted 2656
5 SASI_Hs01_00131621 predicted 7141
6 SASI_Hs02_00333453 predicted 5448
7 SASI_Hs01_00131623 predicted 4610
8 SASI_Hs02_00333454 predicted 6460
9 SASI_Hs02_00333455 predicted 6353
10 SASI_Hs02_00333456 predicted 7800
11 SASI_Hs01_00131616 predicted 5910
12 SASI_Hs01_00131619 predicted 6188
13 SASI_Hs01_00131620 predicted 4043
14 SASI_Hs01_00131622 predicted 425
15 SASI_Hs01_00131624 predicted 2659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013138 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041794 predicted 1060
2 SASI_Rn01_00041795 predicted 2990
3 SASI_Rn01_00041796 predicted 8021
4 SASI_Rn01_00041797 predicted 7498
5 SASI_Rn01_00041799 predicted 5325
6 SASI_Rn01_00041800 predicted 6491
7 SASI_Rn01_00041801 predicted 2571
8 SASI_Rn01_00041802 predicted 7824
9 SASI_Rn01_00041803 predicted 2891
10 SASI_Rn02_00260937 predicted 511
11 SASI_Rn01_00041798 predicted 5436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080553 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026614 predicted 633
2 SASI_Mm01_00026615 predicted 7202
3 SASI_Mm01_00026616 predicted 7969
4 SASI_Mm01_00026617 predicted 522
5 SASI_Mm01_00026618 predicted 1215
6 SASI_Mm01_00026619 predicted 6645
7 SASI_Mm01_00026620 predicted 8168
8 SASI_Mm01_00026621 predicted 3775
9 SASI_Mm01_00026622 predicted 7032
10 SASI_Mm01_00026623 predicted 6302
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080553
ITPR3 MISSION shRNA Bacterial Glycerol Stock
inositol 1,4,5-trisphosphate receptor, type 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080553.3-7328s21c1
Sequence:CCGGACCGAGAGGAGACGCTGTTTACTCGAGTAAACAGCGTCTCCTCTCGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080553.3-4517s21c1
Sequence:CCGGCTTATGTGAACTTCGTGAATCCTCGAGGATTCACGAAGTTCACATAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080553.3-3776s21c1
Sequence:CCGGGCAGCGAGAACTACCAGATTGCTCGAGCAATCTGGTAGTTCTCGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080553.3-2701s21c1
Sequence:CCGGCCCACGGCCATCACCATTAAACTCGAGTTTAATGGTGATGGCCGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080553.1-1714s1c1
Sequence:CCGGCCTGCTTAGTACCGTTGAAGACTCGAGTCTTCAACGGTACTAAGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080553.1-1252s1c1
Sequence:CCGGCCGAGTCAAGAACAAGACAGACTCGAGTCTGTCTTGTTCTTGACTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080553.1-655s1c1
Sequence:CCGGCCTCATCCTTGTGTACCTCTTCTCGAGAAGAGGTACACAAGGATGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080553.1-395s1c1
Sequence:CCGGCTGACCAACAAGATCGTGTTTCTCGAGAAACACGATCTTGTTGGTCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080553.1-157s1c1
Sequence:CCGGCCTGGCTGTGTTCATCAATATCTCGAGATATTGATGAACACAGCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080553
ITPR3 MISSION shRNA shRNA Plasmid DNA
inositol 1,4,5-trisphosphate receptor, type 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080553.3-7328s21c1
Sequence:CCGGACCGAGAGGAGACGCTGTTTACTCGAGTAAACAGCGTCTCCTCTCGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080553.3-4517s21c1
Sequence:CCGGCTTATGTGAACTTCGTGAATCCTCGAGGATTCACGAAGTTCACATAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080553.3-3776s21c1
Sequence:CCGGGCAGCGAGAACTACCAGATTGCTCGAGCAATCTGGTAGTTCTCGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080553.3-2701s21c1
Sequence:CCGGCCCACGGCCATCACCATTAAACTCGAGTTTAATGGTGATGGCCGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080553.1-1714s1c1
Sequence:CCGGCCTGCTTAGTACCGTTGAAGACTCGAGTCTTCAACGGTACTAAGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080553.1-1252s1c1
Sequence:CCGGCCGAGTCAAGAACAAGACAGACTCGAGTCTGTCTTGTTCTTGACTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080553.1-655s1c1
Sequence:CCGGCCTCATCCTTGTGTACCTCTTCTCGAGAAGAGGTACACAAGGATGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080553.1-395s1c1
Sequence:CCGGCTGACCAACAAGATCGTGTTTCTCGAGAAACACGATCTTGTTGGTCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080553.1-157s1c1
Sequence:CCGGCCTGGCTGTGTTCATCAATATCTCGAGATATTGATGAACACAGCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080553
ITPR3 MISSION shRNA Lentiviral Transduction Particles
inositol 1,4,5-trisphosphate receptor, type 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080553.3-7328s21c1
Sequence:CCGGACCGAGAGGAGACGCTGTTTACTCGAGTAAACAGCGTCTCCTCTCGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080553.3-4517s21c1
Sequence:CCGGCTTATGTGAACTTCGTGAATCCTCGAGGATTCACGAAGTTCACATAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080553.3-3776s21c1
Sequence:CCGGGCAGCGAGAACTACCAGATTGCTCGAGCAATCTGGTAGTTCTCGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080553.3-2701s21c1
Sequence:CCGGCCCACGGCCATCACCATTAAACTCGAGTTTAATGGTGATGGCCGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080553.1-1714s1c1
Sequence:CCGGCCTGCTTAGTACCGTTGAAGACTCGAGTCTTCAACGGTACTAAGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080553.1-1252s1c1
Sequence:CCGGCCGAGTCAAGAACAAGACAGACTCGAGTCTGTCTTGTTCTTGACTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080553.1-655s1c1
Sequence:CCGGCCTCATCCTTGTGTACCTCTTCTCGAGAAGAGGTACACAAGGATGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080553.1-395s1c1
Sequence:CCGGCTGACCAACAAGATCGTGTTTCTCGAGAAACACGATCTTGTTGGTCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080553.1-157s1c1
Sequence:CCGGCCTGGCTGTGTTCATCAATATCTCGAGATATTGATGAACACAGCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002224
VALIDATED
ITPR3 MISSION shRNA Bacterial Glycerol Stock
inositol 1,4,5-trisphosphate receptor, type 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000333311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002224.2-591s21c1
Sequence:CCGGCCTGCACATGAAGAGCAACAACTCGAGTTGTTGCTCTTCATGTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002224.2-6855s21c1
Sequence:CCGGCGTGTTTATCAACATCATCATCTCGAGATGATGATGTTGATAAACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002224.2-7788s21c1
Sequence:CCGGGCGTAGTGAGAAGCAGAAGAACTCGAGTTCTTCTGCTTCTCACTACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002224.2-2689s21c1
Sequence:CCGGGATGACAAGAAGAACAAGTTTCTCGAGAAACTTGTTCTTCTTGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002224.1-6672s1c1
Sequence:CCGGCGTGTTTATCAACATCATCATCTCGAGATGATGATGTTGATAAACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002224.1-2506s1c1
Sequence:CCGGGATGACAAGAAGAACAAGTTTCTCGAGAAACTTGTTCTTCTTGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002224.1-7605s1c1
Sequence:CCGGGCGTAGTGAGAAGCAGAAGAACTCGAGTTCTTCTGCTTCTCACTACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002224.1-7764s1c1
Sequence:CCGGCGTGAAGAACAAGACCGACTACTCGAGTAGTCGGTCTTGTTCTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002224.1-408s1c1
Sequence:CCGGCCTGCACATGAAGAGCAACAACTCGAGTTGTTGCTCTTCATGTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002224
VALIDATED
ITPR3 MISSION shRNA shRNA Plasmid DNA
inositol 1,4,5-trisphosphate receptor, type 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000333311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002224.2-591s21c1
Sequence:CCGGCCTGCACATGAAGAGCAACAACTCGAGTTGTTGCTCTTCATGTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002224.2-6855s21c1
Sequence:CCGGCGTGTTTATCAACATCATCATCTCGAGATGATGATGTTGATAAACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002224.2-7788s21c1
Sequence:CCGGGCGTAGTGAGAAGCAGAAGAACTCGAGTTCTTCTGCTTCTCACTACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002224.2-2689s21c1
Sequence:CCGGGATGACAAGAAGAACAAGTTTCTCGAGAAACTTGTTCTTCTTGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002224.1-6672s1c1
Sequence:CCGGCGTGTTTATCAACATCATCATCTCGAGATGATGATGTTGATAAACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002224.1-2506s1c1
Sequence:CCGGGATGACAAGAAGAACAAGTTTCTCGAGAAACTTGTTCTTCTTGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002224.1-7605s1c1
Sequence:CCGGGCGTAGTGAGAAGCAGAAGAACTCGAGTTCTTCTGCTTCTCACTACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002224.1-7764s1c1
Sequence:CCGGCGTGAAGAACAAGACCGACTACTCGAGTAGTCGGTCTTGTTCTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002224.1-408s1c1
Sequence:CCGGCCTGCACATGAAGAGCAACAACTCGAGTTGTTGCTCTTCATGTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002224
VALIDATED
ITPR3 MISSION shRNA Lentiviral Transduction Particles
inositol 1,4,5-trisphosphate receptor, type 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000333311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002224.2-591s21c1
Sequence:CCGGCCTGCACATGAAGAGCAACAACTCGAGTTGTTGCTCTTCATGTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002224.2-6855s21c1
Sequence:CCGGCGTGTTTATCAACATCATCATCTCGAGATGATGATGTTGATAAACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002224.2-7788s21c1
Sequence:CCGGGCGTAGTGAGAAGCAGAAGAACTCGAGTTCTTCTGCTTCTCACTACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002224.2-2689s21c1
Sequence:CCGGGATGACAAGAAGAACAAGTTTCTCGAGAAACTTGTTCTTCTTGTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002224.1-6672s1c1
Sequence:CCGGCGTGTTTATCAACATCATCATCTCGAGATGATGATGTTGATAAACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002224.1-2506s1c1
Sequence:CCGGGATGACAAGAAGAACAAGTTTCTCGAGAAACTTGTTCTTCTTGTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002224.1-7605s1c1
Sequence:CCGGGCGTAGTGAGAAGCAGAAGAACTCGAGTTCTTCTGCTTCTCACTACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002224.1-7764s1c1
Sequence:CCGGCGTGAAGAACAAGACCGACTACTCGAGTAGTCGGTCTTGTTCTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002224.1-408s1c1
Sequence:CCGGCCTGCACATGAAGAGCAACAACTCGAGTTGTTGCTCTTCATGTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)