EMAIL THIS PAGE TO A FRIEND

ITPRIP

inositol 1,4,5-trisphosphate receptor interacting protein

76 Gene Product Result for
Synonyms: DANGER KIAA1754 bA127L20 bA127L20.2
UniProtKB ID: Q8IWB1, D3DRA5, Q5JU17, Q96MS8, Q9C0A9
Gene ID:
Human(85450) Summary: This gene encodes a membrane-associated protein that binds the inositol 1,4,5-trisphosphate receptor (ITPR). The encoded protein enhances the sensitivity of ITPR to intracellular calcium signaling. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Mouse(414801) inositol 1,4,5-triphosphate receptor interacting protein
Rat(499370) inositol 1,4,5-trisphosphate receptor interacting protein
Zebrafish(550570) inositol 1,4,5-triphosphate receptor interacting protein
cow(538685) inositol 1,4,5-trisphosphate receptor interacting protein
domestic cat(101090553) inositol 1,4,5-trisphosphate receptor interacting protein
dog(609723) inositol 1,4,5-trisphosphate receptor interacting protein
chicken(428979) inositol 1,4,5-trisphosphate receptor interacting protein
sheep(101115746) inositol 1,4,5-trisphosphate receptor interacting protein
Domestic Rabbit(100340086) inositol 1,4,5-trisphosphate receptor interacting protein
domestic guinea pig(100720083) inositol 1,4,5-trisphosphate receptor interacting protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033397 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033397 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033397 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001001738 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001738 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001738 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033397 Rosetta Predictions human pricing
XM_001060298 Rosetta Predictions rat pricing
XM_574685 Rosetta Predictions rat pricing
NM_001001738 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033397 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176130 predicted 1991
2 SASI_Hs01_00176131 predicted 1343
3 SASI_Hs02_00361273 predicted 1508
4 SASI_Hs01_00176133 predicted 2482
5 SASI_Hs01_00176134 predicted 2320
6 SASI_Hs01_00176135 predicted 1312
7 SASI_Hs01_00176136 predicted 2399
8 SASI_Hs01_00176137 predicted 722
9 SASI_Hs01_00176138 predicted 2298
10 SASI_Hs02_00361274 predicted 1982
11 SASI_Hs01_00176132 predicted 2575
12 SASI_Hs01_00176139 predicted 2568
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060298 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295963 predicted 911
2 SASI_Rn02_00295964 predicted 440
3 SASI_Rn02_00295965 predicted 548
4 SASI_Rn02_00295966 predicted 1566
5 SASI_Rn02_00295967 predicted 1883
6 SASI_Rn02_00295968 predicted 1030
7 SASI_Rn02_00295969 predicted 236
8 SASI_Rn02_00295970 predicted 1865
9 SASI_Rn02_00295971 predicted 1694
10 SASI_Rn02_00295972 predicted 956
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574685 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402400 predicted 909
2 SASI_Rn02_00402401 predicted 436
3 SASI_Rn02_00402402 predicted 541
4 SASI_Rn02_00402403 predicted 1568
5 SASI_Rn02_00402404 predicted 1884
6 SASI_Rn02_00402405 predicted 1036
7 SASI_Rn02_00402406 predicted 231
8 SASI_Rn02_00402407 predicted 1871
9 SASI_Rn02_00402408 predicted 1696
10 SASI_Rn02_00402409 predicted 960
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001738 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173855 predicted 1085
2 SASI_Mm01_00173856 predicted 1994
3 SASI_Mm01_00173858 predicted 1932
4 SASI_Mm01_00173859 predicted 764
5 SASI_Mm01_00173860 predicted 1751
6 SASI_Mm02_00286202 predicted 2130
7 SASI_Mm01_00173861 predicted 2071
8 SASI_Mm01_00173862 predicted 957
9 SASI_Mm01_00173863 predicted 1341
10 SASI_Mm01_00173864 predicted 2000
11 SASI_Mm01_00173857 predicted 1820
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033397
ITPRIP MISSION shRNA Bacterial Glycerol Stock
inositol 1,4,5-trisphosphate receptor interacting protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033397.2-1497s1c1
Sequence:CCGGGATTCCTGTGATCCAGTGTGACTCGAGTCACACTGGATCACAGGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033397.2-1981s1c1
Sequence:CCGGCGAAGCCTTTACCGTAAGACACTCGAGTGTCTTACGGTAAAGGCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033397.2-1344s1c1
Sequence:CCGGGATGCAGGTCATGAAGTGGTTCTCGAGAACCACTTCATGACCTGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149376    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033397.2-2274s1c1
Sequence:CCGGGCTGGTTTGCTTCATACCATTCTCGAGAATGGTATGAAGCAAACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033397.2-732s1c1
Sequence:CCGGCATGATCCTCTTCCTGATGATCTCGAGATCATCAGGAAGAGGATCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146671    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033397.2-2902s1c1
Sequence:CCGGCCTCTCTTTATTCTCTCCAAACTCGAGTTTGGAGAGAATAAAGAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033397.2-2421s21c1
Sequence:CCGGATGTTGGATTGGGTGTAATTCCTCGAGGAATTACACCCAATCCAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033397.2-2036s21c1
Sequence:CCGGCAGCGCTCATTAGCGAGTATTCTCGAGAATACTCGCTAATGAGCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033397
ITPRIP MISSION shRNA shRNA Plasmid DNA
inositol 1,4,5-trisphosphate receptor interacting protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033397.2-1497s1c1
Sequence:CCGGGATTCCTGTGATCCAGTGTGACTCGAGTCACACTGGATCACAGGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033397.2-1981s1c1
Sequence:CCGGCGAAGCCTTTACCGTAAGACACTCGAGTGTCTTACGGTAAAGGCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033397.2-1344s1c1
Sequence:CCGGGATGCAGGTCATGAAGTGGTTCTCGAGAACCACTTCATGACCTGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149376    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033397.2-2274s1c1
Sequence:CCGGGCTGGTTTGCTTCATACCATTCTCGAGAATGGTATGAAGCAAACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033397.2-732s1c1
Sequence:CCGGCATGATCCTCTTCCTGATGATCTCGAGATCATCAGGAAGAGGATCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146671    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033397.2-2902s1c1
Sequence:CCGGCCTCTCTTTATTCTCTCCAAACTCGAGTTTGGAGAGAATAAAGAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033397.2-2421s21c1
Sequence:CCGGATGTTGGATTGGGTGTAATTCCTCGAGGAATTACACCCAATCCAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033397.2-2036s21c1
Sequence:CCGGCAGCGCTCATTAGCGAGTATTCTCGAGAATACTCGCTAATGAGCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033397
ITPRIP MISSION shRNA Lentiviral Transduction Particles
inositol 1,4,5-trisphosphate receptor interacting protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033397.2-1497s1c1
Sequence:CCGGGATTCCTGTGATCCAGTGTGACTCGAGTCACACTGGATCACAGGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033397.2-1981s1c1
Sequence:CCGGCGAAGCCTTTACCGTAAGACACTCGAGTGTCTTACGGTAAAGGCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033397.2-1344s1c1
Sequence:CCGGGATGCAGGTCATGAAGTGGTTCTCGAGAACCACTTCATGACCTGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149376    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033397.2-2274s1c1
Sequence:CCGGGCTGGTTTGCTTCATACCATTCTCGAGAATGGTATGAAGCAAACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033397.2-732s1c1
Sequence:CCGGCATGATCCTCTTCCTGATGATCTCGAGATCATCAGGAAGAGGATCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146671    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033397.2-2902s1c1
Sequence:CCGGCCTCTCTTTATTCTCTCCAAACTCGAGTTTGGAGAGAATAAAGAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033397.2-2421s21c1
Sequence:CCGGATGTTGGATTGGGTGTAATTCCTCGAGGAATTACACCCAATCCAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033397.2-2036s21c1
Sequence:CCGGCAGCGCTCATTAGCGAGTATTCTCGAGAATACTCGCTAATGAGCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001738
ITPRIP MISSION shRNA Bacterial Glycerol Stock
inositol 1,4,5-trisphosphate receptor interacting protein
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001738.1-723s1c1
Sequence:CCGGCATGGAATTGGAGGACTTCATCTCGAGATGAAGTCCTCCAATTCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001738.1-2858s1c1
Sequence:CCGGCCAGACTTAAAGAAGGTGGTACTCGAGTACCACCTTCTTTAAGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001738.1-1111s1c1
Sequence:CCGGCACAAGTATGAGTTTGACCTTCTCGAGAAGGTCAAACTCATACTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001738.1-1234s1c1
Sequence:CCGGGACCTGTACTTCATCTTACAACTCGAGTTGTAAGATGAAGTACAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001738
ITPRIP MISSION shRNA shRNA Plasmid DNA
inositol 1,4,5-trisphosphate receptor interacting protein
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001738.1-723s1c1
Sequence:CCGGCATGGAATTGGAGGACTTCATCTCGAGATGAAGTCCTCCAATTCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001738.1-2858s1c1
Sequence:CCGGCCAGACTTAAAGAAGGTGGTACTCGAGTACCACCTTCTTTAAGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001738.1-1111s1c1
Sequence:CCGGCACAAGTATGAGTTTGACCTTCTCGAGAAGGTCAAACTCATACTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001738.1-1234s1c1
Sequence:CCGGGACCTGTACTTCATCTTACAACTCGAGTTGTAAGATGAAGTACAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001738
ITPRIP MISSION shRNA Lentiviral Transduction Particles
inositol 1,4,5-trisphosphate receptor interacting protein
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001738.1-723s1c1
Sequence:CCGGCATGGAATTGGAGGACTTCATCTCGAGATGAAGTCCTCCAATTCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001738.1-2858s1c1
Sequence:CCGGCCAGACTTAAAGAAGGTGGTACTCGAGTACCACCTTCTTTAAGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001738.1-1111s1c1
Sequence:CCGGCACAAGTATGAGTTTGACCTTCTCGAGAAGGTCAAACTCATACTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001738.1-1234s1c1
Sequence:CCGGGACCTGTACTTCATCTTACAACTCGAGTTGTAAGATGAAGTACAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)