EMAIL THIS PAGE TO A FRIEND

ITPRIPL1

inositol 1,4,5-trisphosphate receptor interacting protein-like 1

79 Gene Product Result for
Synonyms: KIAA1754L
UniProtKB ID: Q6GPH6, Q8NE61
Gene ID:
Mouse(73338) inositol 1,4,5-triphosphate receptor interacting protein-like 1
Rat(499885) inositol 1,4,5-trisphosphate receptor interacting protein-like 1
domestic guinea pig(100715990) inositol 1,4,5-trisphosphate receptor interacting protein-like 1
naked mole-rat(101704650) inositol 1,4,5-trisphosphate receptor interacting protein-like 1
sheep(101112893) inositol 1,4,5-trisphosphate receptor interacting protein-like 1
domestic cat(101091933) inositol 1,4,5-trisphosphate receptor interacting protein-like 1
cow(539436) inositol 1,4,5-trisphosphate receptor interacting protein-like 1
dog(611643) inositol 1,4,5-trisphosphate receptor interacting protein-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001163528 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001163528 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001163528 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178495 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178495 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178495 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008949 Rosetta Predictions human pricing
NM_178495 Rosetta Predictions human pricing
NM_001025043 Rosetta Predictions rat pricing
XM_485065 Rosetta Predictions mouse pricing
XM_918079 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008949 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207933 predicted 1505
2 SASI_Hs01_00207934 predicted 640
3 SASI_Hs01_00207937 predicted 859
4 SASI_Hs01_00207938 predicted 1235
5 SASI_Hs01_00207939 predicted 1359
6 SASI_Hs02_00305601 predicted 631
7 SASI_Hs01_00207940 predicted 943
8 SASI_Hs01_00207941 predicted 985
9 SASI_Hs01_00207942 predicted 1294
10 SASI_Hs02_00305602 predicted 1176
11 SASI_Hs01_00207935 predicted 1256
12 SASI_Hs01_00207936 predicted 1040
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178495 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240296 predicted 1655
2 SASI_Hs01_00240297 predicted 800
3 SASI_Hs01_00240300 predicted 1024
4 SASI_Hs01_00240301 predicted 1396
5 SASI_Hs01_00240302 predicted 1517
6 SASI_Hs02_00369731 predicted 783
7 SASI_Hs01_00240303 predicted 1096
8 SASI_Hs01_00240304 predicted 1145
9 SASI_Hs01_00240305 predicted 1450
10 SASI_Hs02_00369732 predicted 1334
11 SASI_Hs01_00240298 predicted 1412
12 SASI_Hs01_00240299 predicted 1196
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025043 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053984 predicted 203
2 SASI_Rn01_00053985 predicted 918
3 SASI_Rn01_00053986 predicted 1640
4 SASI_Rn01_00053987 predicted 217
5 SASI_Rn01_00053988 predicted 337
6 SASI_Rn01_00053989 predicted 736
7 SASI_Rn01_00053990 predicted 875
8 SASI_Rn01_00053991 predicted 1339
9 SASI_Rn02_00202972 predicted 1375
10 SASI_Rn01_00053992 predicted 229
11 SASI_Rn01_00053993 predicted 1045
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_485065 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00426595 predicted 1597
2 SASI_Mm02_00426596 predicted 1471
3 SASI_Mm02_00426597 predicted 1624
4 SASI_Mm02_00426598 predicted 1553
5 SASI_Mm02_00426599 predicted 470
6 SASI_Mm02_00426600 predicted 1430
7 SASI_Mm02_00426601 predicted 1441
8 SASI_Mm02_00426602 predicted 1662
9 SASI_Mm02_00426603 predicted 1458
10 SASI_Mm02_00426604 predicted 412
11 SASI_Mm01_00269900 predicted 1271
12 SASI_Mm01_00269901 predicted 789
13 SASI_Mm01_00269902 predicted 259
14 SASI_Mm01_00269903 predicted 1177
15 SASI_Mm01_00269904 predicted 250
16 SASI_Mm01_00269905 predicted 1082
17 SASI_Mm01_00269906 predicted 988
18 SASI_Mm01_00269907 predicted 657
19 SASI_Mm01_00269908 predicted 877
20 SASI_Mm01_00269909 predicted 562
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_918079 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00441661 predicted 1267
2 SASI_Mm02_00441662 predicted 787
3 SASI_Mm02_00441663 predicted 977
4 SASI_Mm02_00441664 predicted 1620
5 SASI_Mm02_00441665 predicted 881
6 SASI_Mm02_00441666 predicted 877
7 SASI_Mm02_00441667 predicted 1546
8 SASI_Mm02_00441668 predicted 1082
9 SASI_Mm02_00441669 predicted 560
10 SASI_Mm02_00441670 predicted 1111
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163528
ITPRIPL1 MISSION shRNA Bacterial Glycerol Stock
inositol 1,4,5-trisphosphate receptor interacting protein-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163528.1-2074s21c1
Sequence:CCGGTGTTGCACTGTTAGCGTAATTCTCGAGAATTACGCTAACAGTGCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163528.1-1706s21c1
Sequence:CCGGCAGTGGCTGGAGGACTTTAATCTCGAGATTAAAGTCCTCCAGCCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163528.1-1611s21c1
Sequence:CCGGTTTCCAGCACCTGGTACTAAACTCGAGTTTAGTACCAGGTGCTGGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163528.1-745s21c1
Sequence:CCGGCTCCACGAGACCCAGAATTTCCTCGAGGAAATTCTGGGTCTCGTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163528.1-1055s21c1
Sequence:CCGGTGGCCCACAAATACGACTTTACTCGAGTAAAGTCGTATTTGTGGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163528
ITPRIPL1 MISSION shRNA shRNA Plasmid DNA
inositol 1,4,5-trisphosphate receptor interacting protein-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163528.1-2074s21c1
Sequence:CCGGTGTTGCACTGTTAGCGTAATTCTCGAGAATTACGCTAACAGTGCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163528.1-1706s21c1
Sequence:CCGGCAGTGGCTGGAGGACTTTAATCTCGAGATTAAAGTCCTCCAGCCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163528.1-1611s21c1
Sequence:CCGGTTTCCAGCACCTGGTACTAAACTCGAGTTTAGTACCAGGTGCTGGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163528.1-745s21c1
Sequence:CCGGCTCCACGAGACCCAGAATTTCCTCGAGGAAATTCTGGGTCTCGTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163528.1-1055s21c1
Sequence:CCGGTGGCCCACAAATACGACTTTACTCGAGTAAAGTCGTATTTGTGGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163528
ITPRIPL1 MISSION shRNA Lentiviral Transduction Particles
inositol 1,4,5-trisphosphate receptor interacting protein-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163528.1-2074s21c1
Sequence:CCGGTGTTGCACTGTTAGCGTAATTCTCGAGAATTACGCTAACAGTGCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163528.1-1706s21c1
Sequence:CCGGCAGTGGCTGGAGGACTTTAATCTCGAGATTAAAGTCCTCCAGCCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163528.1-1611s21c1
Sequence:CCGGTTTCCAGCACCTGGTACTAAACTCGAGTTTAGTACCAGGTGCTGGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163528.1-745s21c1
Sequence:CCGGCTCCACGAGACCCAGAATTTCCTCGAGGAAATTCTGGGTCTCGTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163528.1-1055s21c1
Sequence:CCGGTGGCCCACAAATACGACTTTACTCGAGTAAAGTCGTATTTGTGGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178495
VALIDATED
ITPRIPL1 MISSION shRNA Bacterial Glycerol Stock
inositol 1,4,5-trisphosphate receptor interacting protein-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000271416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178495.4-1094s21c1
Sequence:CCGGCTCCATGAGACCCAGAAATTTCTCGAGAAATTTCTGGGTCTCATGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178495.4-1668s21c1
Sequence:CCGGTCAAGTGCCTCCAGATCATTTCTCGAGAAATGATCTGGAGGCACTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178495.4-1027s21c1
Sequence:CCGGCCAAGAGGCTCACCCACAATTCTCGAGAATTGTGGGTGAGCCTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178495.4-503s21c1
Sequence:CCGGCGGATGGACCTGGACACATTACTCGAGTAATGTGTCCAGGTCCATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178495.3-1929s1c1
Sequence:CCGGCCTAAGACATTTAGGAATGCTCTCGAGAGCATTCCTAAATGTCTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_178495.3-867s1c1
Sequence:CCGGGTCACCTCTTACAACTGGCTTCTCGAGAAGCCAGTTGTAAGAGGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178495.4-1409s21c1
Sequence:CCGGGCCCACAAGTATGACTTTAAACTCGAGTTTAAAGTCATACTTGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178495.3-1868s1c1
Sequence:CCGGGCAAAGGTCCCTCCATCATTTCTCGAGAAATGATGGAGGGACCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178495.3-1301s1c1
Sequence:CCGGGAAGTGTAGTAGCTCCATCAACTCGAGTTGATGGAGCTACTACACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178495.3-545s1c1
Sequence:CCGGGAAGCGAATGAGTGAGGAGATCTCGAGATCTCCTCACTCATTCGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178495
VALIDATED
ITPRIPL1 MISSION shRNA shRNA Plasmid DNA
inositol 1,4,5-trisphosphate receptor interacting protein-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000271416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178495.4-1094s21c1
Sequence:CCGGCTCCATGAGACCCAGAAATTTCTCGAGAAATTTCTGGGTCTCATGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178495.4-1668s21c1
Sequence:CCGGTCAAGTGCCTCCAGATCATTTCTCGAGAAATGATCTGGAGGCACTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178495.4-1027s21c1
Sequence:CCGGCCAAGAGGCTCACCCACAATTCTCGAGAATTGTGGGTGAGCCTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178495.4-503s21c1
Sequence:CCGGCGGATGGACCTGGACACATTACTCGAGTAATGTGTCCAGGTCCATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178495.3-1929s1c1
Sequence:CCGGCCTAAGACATTTAGGAATGCTCTCGAGAGCATTCCTAAATGTCTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_178495.3-867s1c1
Sequence:CCGGGTCACCTCTTACAACTGGCTTCTCGAGAAGCCAGTTGTAAGAGGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178495.4-1409s21c1
Sequence:CCGGGCCCACAAGTATGACTTTAAACTCGAGTTTAAAGTCATACTTGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178495.3-1868s1c1
Sequence:CCGGGCAAAGGTCCCTCCATCATTTCTCGAGAAATGATGGAGGGACCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178495.3-1301s1c1
Sequence:CCGGGAAGTGTAGTAGCTCCATCAACTCGAGTTGATGGAGCTACTACACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178495.3-545s1c1
Sequence:CCGGGAAGCGAATGAGTGAGGAGATCTCGAGATCTCCTCACTCATTCGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178495
VALIDATED
ITPRIPL1 MISSION shRNA Lentiviral Transduction Particles
inositol 1,4,5-trisphosphate receptor interacting protein-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000271416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178495.4-1094s21c1
Sequence:CCGGCTCCATGAGACCCAGAAATTTCTCGAGAAATTTCTGGGTCTCATGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178495.4-1668s21c1
Sequence:CCGGTCAAGTGCCTCCAGATCATTTCTCGAGAAATGATCTGGAGGCACTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178495.4-1027s21c1
Sequence:CCGGCCAAGAGGCTCACCCACAATTCTCGAGAATTGTGGGTGAGCCTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178495.4-503s21c1
Sequence:CCGGCGGATGGACCTGGACACATTACTCGAGTAATGTGTCCAGGTCCATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178495.3-1929s1c1
Sequence:CCGGCCTAAGACATTTAGGAATGCTCTCGAGAGCATTCCTAAATGTCTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_178495.3-867s1c1
Sequence:CCGGGTCACCTCTTACAACTGGCTTCTCGAGAAGCCAGTTGTAAGAGGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178495.4-1409s21c1
Sequence:CCGGGCCCACAAGTATGACTTTAAACTCGAGTTTAAAGTCATACTTGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178495.3-1868s1c1
Sequence:CCGGGCAAAGGTCCCTCCATCATTTCTCGAGAAATGATGGAGGGACCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178495.3-1301s1c1
Sequence:CCGGGAAGTGTAGTAGCTCCATCAACTCGAGTTGATGGAGCTACTACACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178495.3-545s1c1
Sequence:CCGGGAAGCGAATGAGTGAGGAGATCTCGAGATCTCCTCACTCATTCGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)