EMAIL THIS PAGE TO A FRIEND

ITPRIPL2

inositol 1,4,5-trisphosphate receptor interacting protein-like 2

66 Gene Product Result for
UniProtKB ID: Q3MIP1
Gene ID:
Mouse(319622) inositol 1,4,5-triphosphate receptor interacting protein-like 2
Rat(499253) inositol 1,4,5-trisphosphate receptor interacting protein-like 2
chicken(771589) inositol 1,4,5-trisphosphate receptor interacting protein-like 2
cow(783291) inositol 1,4,5-trisphosphate receptor interacting protein-like 2
domestic cat(101094470) inositol 1,4,5-trisphosphate receptor interacting protein-like 2
dog(100683434) inositol 1,4,5-trisphosphate receptor interacting protein-like 2
sheep(101112279) inositol 1,4,5-trisphosphate receptor interacting protein-like 2
domestic guinea pig(100732710) inositol 1,4,5-trisphosphate receptor interacting protein-like 2
naked mole-rat(101699611) inositol 1,4,5-trisphosphate receptor interacting protein-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033380 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033380 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033380 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001034841 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001034841 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001034841 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001034841 Rosetta Predictions human pricing
XM_928728 Rosetta Predictions human pricing
XM_933086 Rosetta Predictions human pricing
NM_001127303 Rosetta Predictions rat pricing
NM_001033380 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034841 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104517 predicted 783
2 SASI_Hs01_00104519 predicted 751
3 SASI_Hs02_00308143 predicted 1978
4 SASI_Hs01_00104521 predicted 1693
5 SASI_Hs01_00104522 predicted 836
6 SASI_Hs02_00308144 predicted 2252
7 SASI_Hs01_00104523 predicted 1196
8 SASI_Hs02_00308145 predicted 2258
9 SASI_Hs01_00104524 predicted 1164
10 SASI_Hs02_00308146 predicted 2230
11 SASI_Hs01_00104518 predicted 1292
12 SASI_Hs01_00104520 predicted 368
13 SASI_Hs01_00104525 predicted 433
14 SASI_Hs01_00104526 predicted 1193
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928728 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00293253 predicted 770
2 SASI_Hs01_00293254 predicted 1689
3 SASI_Hs01_00293255 predicted 735
4 SASI_Hs01_00293256 predicted 771
5 SASI_Hs01_00293257 predicted 1670
6 SASI_Hs01_00293258 predicted 816
7 SASI_Hs01_00293259 predicted 1180
8 SASI_Hs01_00293260 predicted 1148
9 SASI_Hs01_00293261 predicted 826
10 SASI_Hs01_00293262 predicted 1581
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933086 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00277007 predicted 1215
2 SASI_Hs01_00277008 predicted 1350
3 SASI_Hs01_00277009 predicted 1211
4 SASI_Hs01_00277010 predicted 1202
5 SASI_Hs01_00277011 predicted 1028
6 SASI_Hs01_00277012 predicted 1106
7 SASI_Hs01_00277013 predicted 1352
8 SASI_Hs01_00277014 predicted 1341
9 SASI_Hs01_00277015 predicted 1115
10 SASI_Hs01_00277016 predicted 1209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127303 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253593 predicted 1494
2 SASI_Rn02_00253594 predicted 546
3 SASI_Rn02_00253595 predicted 783
4 SASI_Rn02_00253596 predicted 963
5 SASI_Rn02_00253597 predicted 347
6 SASI_Rn02_00253598 predicted 382
7 SASI_Rn02_00253599 predicted 1620
8 SASI_Rn02_00253600 predicted 1313
9 SASI_Rn02_00253601 predicted 1600
10 SASI_Rn02_00253602 predicted 1615
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033380 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196865 predicted 2235
2 SASI_Mm01_00196866 predicted 2386
3 SASI_Mm01_00196867 predicted 768
4 SASI_Mm01_00196868 predicted 1392
5 SASI_Mm01_00196870 predicted 2386
6 SASI_Mm01_00196871 predicted 2246
7 SASI_Mm01_00196872 predicted 1164
8 SASI_Mm02_00288686 predicted 2354
9 SASI_Mm01_00196873 predicted 1978
10 SASI_Mm01_00196874 predicted 2232
11 SASI_Mm01_00196869 predicted 2376
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033380
ITPRIPL2 MISSION shRNA Bacterial Glycerol Stock
inositol 1,4,5-trisphosphate receptor interacting protein-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033380.3-4761s21c1
Sequence:CCGGTGGTGCTGGAGAGTCATATATCTCGAGATATATGACTCTCCAGCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033380.3-1121s21c1
Sequence:CCGGCAGCGCCTATGAACAGCATAACTCGAGTTATGCTGTTCATAGGCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033380.3-948s21c1
Sequence:CCGGAGTTACTATGAGCACGAAGTGCTCGAGCACTTCGTGCTCATAGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033380.3-1775s21c1
Sequence:CCGGGCTTAAGGCTCTTCGAGACTTCTCGAGAAGTCTCGAAGAGCCTTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033380.3-1836s21c1
Sequence:CCGGGGACGTATCCTGTCCTCTTACCTCGAGGTAAGAGGACAGGATACGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033380
ITPRIPL2 MISSION shRNA shRNA Plasmid DNA
inositol 1,4,5-trisphosphate receptor interacting protein-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033380.3-4761s21c1
Sequence:CCGGTGGTGCTGGAGAGTCATATATCTCGAGATATATGACTCTCCAGCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033380.3-1121s21c1
Sequence:CCGGCAGCGCCTATGAACAGCATAACTCGAGTTATGCTGTTCATAGGCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033380.3-948s21c1
Sequence:CCGGAGTTACTATGAGCACGAAGTGCTCGAGCACTTCGTGCTCATAGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033380.3-1775s21c1
Sequence:CCGGGCTTAAGGCTCTTCGAGACTTCTCGAGAAGTCTCGAAGAGCCTTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033380.3-1836s21c1
Sequence:CCGGGGACGTATCCTGTCCTCTTACCTCGAGGTAAGAGGACAGGATACGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033380
ITPRIPL2 MISSION shRNA Lentiviral Transduction Particles
inositol 1,4,5-trisphosphate receptor interacting protein-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033380.3-4761s21c1
Sequence:CCGGTGGTGCTGGAGAGTCATATATCTCGAGATATATGACTCTCCAGCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033380.3-1121s21c1
Sequence:CCGGCAGCGCCTATGAACAGCATAACTCGAGTTATGCTGTTCATAGGCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033380.3-948s21c1
Sequence:CCGGAGTTACTATGAGCACGAAGTGCTCGAGCACTTCGTGCTCATAGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033380.3-1775s21c1
Sequence:CCGGGCTTAAGGCTCTTCGAGACTTCTCGAGAAGTCTCGAAGAGCCTTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033380.3-1836s21c1
Sequence:CCGGGGACGTATCCTGTCCTCTTACCTCGAGGTAAGAGGACAGGATACGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001034841
ITPRIPL2 MISSION shRNA Bacterial Glycerol Stock
inositol 1,4,5-trisphosphate receptor interacting protein-like 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034841.2-982s21c1
Sequence:CCGGCAGCGCCTACGAGCAACATAACTCGAGTTATGTTGCTCGTAGGCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034841.2-1621s21c1
Sequence:CCGGCAAGTGCCTGCAGTTGCTTAACTCGAGTTAAGCAACTGCAGGCACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034841.2-1697s21c1
Sequence:CCGGGGACGCATCCTATCCTCATATCTCGAGATATGAGGATAGGATGCGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034841.2-2092s21c1
Sequence:CCGGCCTTGAAGGTGAACCGTAAACCTCGAGGTTTACGGTTCACCTTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245929    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001034841.2-4859s21c1
Sequence:CCGGACGGAAATAATATGGCATATTCTCGAGAATATGCCATATTATTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001034841
ITPRIPL2 MISSION shRNA shRNA Plasmid DNA
inositol 1,4,5-trisphosphate receptor interacting protein-like 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034841.2-982s21c1
Sequence:CCGGCAGCGCCTACGAGCAACATAACTCGAGTTATGTTGCTCGTAGGCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034841.2-1621s21c1
Sequence:CCGGCAAGTGCCTGCAGTTGCTTAACTCGAGTTAAGCAACTGCAGGCACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034841.2-1697s21c1
Sequence:CCGGGGACGCATCCTATCCTCATATCTCGAGATATGAGGATAGGATGCGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034841.2-2092s21c1
Sequence:CCGGCCTTGAAGGTGAACCGTAAACCTCGAGGTTTACGGTTCACCTTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245929    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001034841.2-4859s21c1
Sequence:CCGGACGGAAATAATATGGCATATTCTCGAGAATATGCCATATTATTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001034841
ITPRIPL2 MISSION shRNA Lentiviral Transduction Particles
inositol 1,4,5-trisphosphate receptor interacting protein-like 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034841.2-982s21c1
Sequence:CCGGCAGCGCCTACGAGCAACATAACTCGAGTTATGTTGCTCGTAGGCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034841.2-1621s21c1
Sequence:CCGGCAAGTGCCTGCAGTTGCTTAACTCGAGTTAAGCAACTGCAGGCACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034841.2-1697s21c1
Sequence:CCGGGGACGCATCCTATCCTCATATCTCGAGATATGAGGATAGGATGCGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034841.2-2092s21c1
Sequence:CCGGCCTTGAAGGTGAACCGTAAACCTCGAGGTTTACGGTTCACCTTCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245929    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001034841.2-4859s21c1
Sequence:CCGGACGGAAATAATATGGCATATTCTCGAGAATATGCCATATTATTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)