EMAIL THIS PAGE TO A FRIEND

ITSN1

intersectin 1 (SH3 domain protein)

283 Gene Product Result for
Synonyms: ITSN SH3D1A SH3P17
Gene ID:
Human(6453) Summary: The protein encoded by this gene is a cytoplasmic membrane-associated protein that indirectly coordinates endocytic membrane traffic with the actin assembly machinery. In addition, the encoded protein may regulate the formation of clathrin-coated vesicles and could be involved in synaptic vesicle recycling. This protein has been shown to interact with dynamin, CDC42, SNAP23, SNAP25, SPIN90, EPS15, EPN1, EPN2, and STN2. Multiple transcript variants encoding different isoforms have been found for this gene, but the full-length nature of only two of them have been characterized so far. [provided by RefSeq, Jul 2008]
Mouse(16443) intersectin 1 (SH3 domain protein 1A)
Rat(29491) intersectin 1 (SH3 domain protein)
Zebrafish(368504) intersectin 1 (SH3 domain protein)
chicken(418506) intersectin 1 (SH3 domain protein)
dog(478409) intersectin 1 (SH3 domain protein)
domestic cat(101087514) intersectin 1 (SH3 domain protein)
cow(510879) intersectin 1 (SH3 domain protein)
domestic guinea pig(100728574) intersectin 1 (SH3 domain protein)
naked mole-rat(101712226) intersectin 1 (SH3 domain protein)
sheep(101120620) intersectin 1 (SH3 domain protein)
Domestic Rabbit(100328814) intersectin 1 (SH3 domain protein)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003024 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003024 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003024 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010587 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010587 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010587 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001132 Rosetta Predictions human pricing
NM_003024 Rosetta Predictions human pricing
XM_001059402 Rosetta Predictions rat pricing
XM_001069789 Rosetta Predictions rat pricing
XM_573259 Rosetta Predictions rat pricing
NM_001110275 Rosetta Predictions mouse pricing
NM_001110276 Rosetta Predictions mouse pricing
NM_010587 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001132 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108876 predicted 2583
2 SASI_Hs01_00108877 predicted 3655
3 SASI_Hs01_00108879 predicted 1814
4 SASI_Hs01_00108880 predicted 3492
5 SASI_Hs01_00108881 predicted 2170
6 SASI_Hs01_00108882 predicted 1107
7 SASI_Hs02_00303709 predicted 3112
8 SASI_Hs01_00108883 predicted 3167
9 SASI_Hs01_00108884 predicted 3404
10 SASI_Hs01_00108885 predicted 1111
11 SASI_Hs01_00108878 predicted 3709
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003024 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116490 predicted 2585
2 SASI_Hs01_00116491 predicted 3655
3 SASI_Hs01_00116493 predicted 1812
4 SASI_Hs01_00116494 predicted 3485
5 SASI_Hs01_00116495 predicted 2170
6 SASI_Hs01_00116496 predicted 1106
7 SASI_Hs02_00334921 predicted 3109
8 SASI_Hs01_00116497 predicted 3161
9 SASI_Hs01_00116498 predicted 3407
10 SASI_Hs01_00116499 predicted 1115
11 SASI_Hs01_00116492 predicted 3707
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059402 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293056 predicted 877
2 SASI_Rn02_00293057 predicted 808
3 SASI_Rn02_00293058 predicted 459
4 SASI_Rn02_00293059 predicted 3693
5 SASI_Rn02_00293060 predicted 648
6 SASI_Rn02_00293061 predicted 634
7 SASI_Rn02_00293062 predicted 791
8 SASI_Rn02_00293063 predicted 1072
9 SASI_Rn02_00293064 predicted 806
10 SASI_Rn02_00293065 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069789 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00329303 predicted 4801
2 SASI_Rn02_00329304 predicted 4941
3 SASI_Rn02_00329305 predicted 802
4 SASI_Rn02_00329306 predicted 3097
5 SASI_Rn02_00329307 predicted 3679
6 SASI_Rn02_00329308 predicted 5311
7 SASI_Rn02_00329309 predicted 3218
8 SASI_Rn02_00329310 predicted 4990
9 SASI_Rn02_00329311 predicted 4980
10 SASI_Rn02_00329312 predicted 2514
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573259 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400084 predicted 876
2 SASI_Rn02_00400085 predicted 804
3 SASI_Rn02_00400086 predicted 458
4 SASI_Rn02_00400087 predicted 654
5 SASI_Rn02_00400088 predicted 638
6 SASI_Rn02_00400089 predicted 787
7 SASI_Rn02_00400090 predicted 1072
8 SASI_Rn02_00400091 predicted 800
9 SASI_Rn02_00400092 predicted 472
10 SASI_Rn02_00400093 predicted 802
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110275 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305276 predicted 846
2 SASI_Mm02_00305277 predicted 1047
3 SASI_Mm02_00305278 predicted 926
4 SASI_Mm02_00305279 predicted 1071
5 SASI_Mm02_00305280 predicted 907
6 SASI_Mm02_00305281 predicted 1776
7 SASI_Mm02_00305282 predicted 1793
8 SASI_Mm02_00305283 predicted 1791
9 SASI_Mm02_00305284 predicted 1787
10 SASI_Mm02_00305285 predicted 848
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110276 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305286 predicted 845
2 SASI_Mm02_00305287 predicted 1042
3 SASI_Mm02_00305288 predicted 923
4 SASI_Mm02_00305289 predicted 1080
5 SASI_Mm02_00305290 predicted 907
6 SASI_Mm02_00305291 predicted 1778
7 SASI_Mm02_00305292 predicted 1802
8 SASI_Mm02_00305293 predicted 1787
9 SASI_Mm02_00305294 predicted 1795
10 SASI_Mm02_00305295 predicted 849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010587 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072475 predicted 846
2 SASI_Mm02_00318880 predicted 1047
3 SASI_Mm02_00318881 predicted 918
4 SASI_Mm02_00318882 predicted 1078
5 SASI_Mm02_00318883 predicted 907
6 SASI_Mm01_00072483 predicted 1774
7 SASI_Mm02_00318884 predicted 1796
8 SASI_Mm02_00318885 predicted 1783
9 SASI_Mm02_00318886 predicted 1787
10 SASI_Mm02_00318887 predicted 857
11 SASI_Mm01_00072474 predicted 3065
12 SASI_Mm01_00072476 predicted 3134
13 SASI_Mm01_00072477 predicted 2883
14 SASI_Mm01_00072478 predicted 3123
15 SASI_Mm01_00072479 predicted 3209
16 SASI_Mm01_00072480 predicted 2929
17 SASI_Mm01_00072481 predicted 3700
18 SASI_Mm01_00072482 predicted 4063
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003024
VALIDATED
ITSN1 MISSION shRNA Bacterial Glycerol Stock
intersectin 1 (SH3 domain protein)
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003024.2-2558s21c1
Sequence:GTACCGGGGAGACATAGTCATGGTTAAACTCGAGTTTAACCATGACTATGTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003024.2-5677s21c1
Sequence:GTACCGGGGCTTCTAGGGTCGCTGAAATCTCGAGATTTCAGCGACCCTAGAAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003024.2-4418s21c1
Sequence:GTACCGGAGATACCCACTGATCATTAAACTCGAGTTTAATGATCAGTGGGTATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003024.2-5753s21c1
Sequence:CCGGGATGGGTCTGGTTACTATAAACTCGAGTTTATAGTAACCAGACCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003024.2-3423s21c1
Sequence:CCGGCTAACTATGTGAGGCTTAAAGCTCGAGCTTTAAGCCTCACATAGTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003024.2-1906s21c1
Sequence:CCGGGATACTCAATGACCAATTAAACTCGAGTTTAATTGGTCATTGAGTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003024.2-1624s21c1
Sequence:CCGGTCGAAGGCAAGAACTACTAAACTCGAGTTTAGTAGTTCTTGCCTTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003024.2-1201s21c1
Sequence:CCGGTCGATCTGGCAGTGGTATATCCTCGAGGATATACCACTGCCAGATCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003024.2-344s21c1
Sequence:GTACCGGGATCAGCAGTTCCATAGTTTACTCGAGTAAACTATGGAACTGCTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003024.2-934s21c1
Sequence:GTACCGGACTGAAATACAGGCAATTATTCTCGAGAATAATTGCCTGTATTTCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003024.2-5853s21c1
Sequence:GTACCGGTAGACTTCTTGGCCTACAATGCTCGAGCATTGTAGGCCAAGAAGTCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003024.2-4349s21c1
Sequence:GTACCGGGCAATGGATCCTCGGTGTAAACTCGAGTTTACACCGAGGATCCATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003024.2-3015s21c1
Sequence:GTACCGGTACAAGCTCAAGCCCTATATCCTCGAGGATATAGGGCTTGAGCTTGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010675    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003024.x-6474s1c1
Sequence:CCGGGCTGTTTGGTTTGAGTTCTTTCTCGAGAAAGAACTCAAACCAAACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_003024.x-5251s1c1
Sequence:CCGGGCAGTTGTTTGATGAGCCGTACTCGAGTACGGCTCATCAAACAACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003024.x-2110s1c1
Sequence:CCGGCGAGCATCAGAGACCAAGAAACTCGAGTTTCTTGGTCTCTGATGCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_003024.x-293s1c1
Sequence:CCGGGCACTAGCTGACATGAATAATCTCGAGATTATTCATGTCAGCTAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_003024.x-2685s1c1
Sequence:CCGGGCACGAATGAGAAACCAGAAACTCGAGTTTCTGGTTTCTCATTCGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003024
VALIDATED
ITSN1 MISSION shRNA shRNA Plasmid DNA
intersectin 1 (SH3 domain protein)
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003024.2-2558s21c1
Sequence:GTACCGGGGAGACATAGTCATGGTTAAACTCGAGTTTAACCATGACTATGTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003024.2-5677s21c1
Sequence:GTACCGGGGCTTCTAGGGTCGCTGAAATCTCGAGATTTCAGCGACCCTAGAAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003024.2-4418s21c1
Sequence:GTACCGGAGATACCCACTGATCATTAAACTCGAGTTTAATGATCAGTGGGTATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003024.2-5753s21c1
Sequence:CCGGGATGGGTCTGGTTACTATAAACTCGAGTTTATAGTAACCAGACCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003024.2-3423s21c1
Sequence:CCGGCTAACTATGTGAGGCTTAAAGCTCGAGCTTTAAGCCTCACATAGTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003024.2-1906s21c1
Sequence:CCGGGATACTCAATGACCAATTAAACTCGAGTTTAATTGGTCATTGAGTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003024.2-1624s21c1
Sequence:CCGGTCGAAGGCAAGAACTACTAAACTCGAGTTTAGTAGTTCTTGCCTTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003024.2-1201s21c1
Sequence:CCGGTCGATCTGGCAGTGGTATATCCTCGAGGATATACCACTGCCAGATCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003024.2-344s21c1
Sequence:GTACCGGGATCAGCAGTTCCATAGTTTACTCGAGTAAACTATGGAACTGCTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003024.2-934s21c1
Sequence:GTACCGGACTGAAATACAGGCAATTATTCTCGAGAATAATTGCCTGTATTTCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003024.2-5853s21c1
Sequence:GTACCGGTAGACTTCTTGGCCTACAATGCTCGAGCATTGTAGGCCAAGAAGTCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003024.2-4349s21c1
Sequence:GTACCGGGCAATGGATCCTCGGTGTAAACTCGAGTTTACACCGAGGATCCATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003024.2-3015s21c1
Sequence:GTACCGGTACAAGCTCAAGCCCTATATCCTCGAGGATATAGGGCTTGAGCTTGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010675    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003024.x-6474s1c1
Sequence:CCGGGCTGTTTGGTTTGAGTTCTTTCTCGAGAAAGAACTCAAACCAAACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_003024.x-5251s1c1
Sequence:CCGGGCAGTTGTTTGATGAGCCGTACTCGAGTACGGCTCATCAAACAACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003024.x-2110s1c1
Sequence:CCGGCGAGCATCAGAGACCAAGAAACTCGAGTTTCTTGGTCTCTGATGCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_003024.x-293s1c1
Sequence:CCGGGCACTAGCTGACATGAATAATCTCGAGATTATTCATGTCAGCTAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_003024.x-2685s1c1
Sequence:CCGGGCACGAATGAGAAACCAGAAACTCGAGTTTCTGGTTTCTCATTCGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003024
VALIDATED
ITSN1 MISSION shRNA Lentiviral Transduction Particles
intersectin 1 (SH3 domain protein)
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003024.2-2558s21c1
Sequence:GTACCGGGGAGACATAGTCATGGTTAAACTCGAGTTTAACCATGACTATGTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003024.2-5677s21c1
Sequence:GTACCGGGGCTTCTAGGGTCGCTGAAATCTCGAGATTTCAGCGACCCTAGAAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003024.2-4418s21c1
Sequence:GTACCGGAGATACCCACTGATCATTAAACTCGAGTTTAATGATCAGTGGGTATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003024.2-5753s21c1
Sequence:CCGGGATGGGTCTGGTTACTATAAACTCGAGTTTATAGTAACCAGACCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003024.2-3423s21c1
Sequence:CCGGCTAACTATGTGAGGCTTAAAGCTCGAGCTTTAAGCCTCACATAGTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003024.2-1906s21c1
Sequence:CCGGGATACTCAATGACCAATTAAACTCGAGTTTAATTGGTCATTGAGTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003024.2-1624s21c1
Sequence:CCGGTCGAAGGCAAGAACTACTAAACTCGAGTTTAGTAGTTCTTGCCTTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003024.2-1201s21c1
Sequence:CCGGTCGATCTGGCAGTGGTATATCCTCGAGGATATACCACTGCCAGATCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003024.2-344s21c1
Sequence:GTACCGGGATCAGCAGTTCCATAGTTTACTCGAGTAAACTATGGAACTGCTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003024.2-934s21c1
Sequence:GTACCGGACTGAAATACAGGCAATTATTCTCGAGAATAATTGCCTGTATTTCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003024.2-5853s21c1
Sequence:GTACCGGTAGACTTCTTGGCCTACAATGCTCGAGCATTGTAGGCCAAGAAGTCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003024.2-4349s21c1
Sequence:GTACCGGGCAATGGATCCTCGGTGTAAACTCGAGTTTACACCGAGGATCCATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003024.2-3015s21c1
Sequence:GTACCGGTACAAGCTCAAGCCCTATATCCTCGAGGATATAGGGCTTGAGCTTGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010675    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003024.x-6474s1c1
Sequence:CCGGGCTGTTTGGTTTGAGTTCTTTCTCGAGAAAGAACTCAAACCAAACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_003024.x-5251s1c1
Sequence:CCGGGCAGTTGTTTGATGAGCCGTACTCGAGTACGGCTCATCAAACAACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003024.x-2110s1c1
Sequence:CCGGCGAGCATCAGAGACCAAGAAACTCGAGTTTCTTGGTCTCTGATGCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_003024.x-293s1c1
Sequence:CCGGGCACTAGCTGACATGAATAATCTCGAGATTATTCATGTCAGCTAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_003024.x-2685s1c1
Sequence:CCGGGCACGAATGAGAAACCAGAAACTCGAGTTTCTGGTTTCTCATTCGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010587
VALIDATED
ITSN1 MISSION shRNA Bacterial Glycerol Stock
intersectin 1 (SH3 domain protein)
Mouse
19 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010587.2-4388s21c1
Sequence:GTACCGGCAAGATACCCGCTGATCATTACTCGAGTAATGATCAGCGGGTATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010587.2-356s21c1
Sequence:CCGGTGAAGCCGATAGCGGGATTTACTCGAGTAAATCCCGCTATCGGCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010587.2-5789s21c1
Sequence:CCGGTAGACTACTTGGCCTATAATACTCGAGTATTATAGGCCAAGTAGTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010587.2-1896s21c1
Sequence:CCGGGATACTCAGTGACCAGTTAAACTCGAGTTTAACTGGTCACTGAGTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010587.2-3395s21c1
Sequence:CCGGCTAACTATGTGAGGCTTAAAGCTCGAGCTTTAAGCCTCACATAGTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010587.2-1099s21c1
Sequence:CCGGATCCTAGCTATGCACCTAATTCTCGAGAATTAGGTGCATAGCTAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010587.2-5898s21c1
Sequence:GTACCGGAGCAGACACCAACGTACTTAACTCGAGTTAAGTACGTTGGTGTCTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010587.2-5522s21c1
Sequence:GTACCGGTAGGAGTCGTTCTCGACAATCCTCGAGGATTGTCGAGAACGACTCCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010587.2-5140s21c1
Sequence:GTACCGGACAATCCAGGACACGCTAAACCTCGAGGTTTAGCGTGTCCTGGATTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010587.1-729s1c1
Sequence:CCGGCCAGGCAAGAACTATTCTCATCTCGAGATGAGAATAGTTCTTGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010587.1-194s1c1
Sequence:CCGGCGGACATGAATAACGATGGAACTCGAGTTCCATCGTTATTCATGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010587.1-1547s1c1
Sequence:CCGGGAGAGCTAAGAATTGCTGAAACTCGAGTTTCAGCAATTCTTAGCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010587.1-4499s1c1
Sequence:CCGGCCAAATCTAACCTTCAGTATACTCGAGTATACTGAAGGTTAGATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010587.1-340s1c1
Sequence:CCGGGCATTTGGTATAGGAGGGATTCTCGAGAATCCCTCCTATACCAAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010587.1-666s1c1
Sequence:CCGGGCTGAAATACAGGCAGTTATTCTCGAGAATAACTGCCTGTATTTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010587.1-1913s1c1
Sequence:CCGGGCCTGGAGTTAGAGAAGCAAACTCGAGTTTGCTTCTCTAACTCCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010587.1-106s1c1
Sequence:CCGGGCGGGATTTATTACTGGTGATCTCGAGATCACCAGTAATAAATCCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010587.1-4094s1c1
Sequence:CCGGCCAGCTTTATACTGAAGCCTACTCGAGTAGGCTTCAGTATAAAGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010587.1-4498s1c1
Sequence:CCGGCCCAAATCTAACCTTCAGTATCTCGAGATACTGAAGGTTAGATTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010587
VALIDATED
ITSN1 MISSION shRNA shRNA Plasmid DNA
intersectin 1 (SH3 domain protein)
Mouse
19 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010587.2-4388s21c1
Sequence:GTACCGGCAAGATACCCGCTGATCATTACTCGAGTAATGATCAGCGGGTATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010587.2-356s21c1
Sequence:CCGGTGAAGCCGATAGCGGGATTTACTCGAGTAAATCCCGCTATCGGCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010587.2-5789s21c1
Sequence:CCGGTAGACTACTTGGCCTATAATACTCGAGTATTATAGGCCAAGTAGTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010587.2-1896s21c1
Sequence:CCGGGATACTCAGTGACCAGTTAAACTCGAGTTTAACTGGTCACTGAGTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010587.2-3395s21c1
Sequence:CCGGCTAACTATGTGAGGCTTAAAGCTCGAGCTTTAAGCCTCACATAGTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010587.2-1099s21c1
Sequence:CCGGATCCTAGCTATGCACCTAATTCTCGAGAATTAGGTGCATAGCTAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010587.2-5898s21c1
Sequence:GTACCGGAGCAGACACCAACGTACTTAACTCGAGTTAAGTACGTTGGTGTCTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010587.2-5522s21c1
Sequence:GTACCGGTAGGAGTCGTTCTCGACAATCCTCGAGGATTGTCGAGAACGACTCCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010587.2-5140s21c1
Sequence:GTACCGGACAATCCAGGACACGCTAAACCTCGAGGTTTAGCGTGTCCTGGATTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010587.1-729s1c1
Sequence:CCGGCCAGGCAAGAACTATTCTCATCTCGAGATGAGAATAGTTCTTGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010587.1-194s1c1
Sequence:CCGGCGGACATGAATAACGATGGAACTCGAGTTCCATCGTTATTCATGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010587.1-1547s1c1
Sequence:CCGGGAGAGCTAAGAATTGCTGAAACTCGAGTTTCAGCAATTCTTAGCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010587.1-4499s1c1
Sequence:CCGGCCAAATCTAACCTTCAGTATACTCGAGTATACTGAAGGTTAGATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010587.1-340s1c1
Sequence:CCGGGCATTTGGTATAGGAGGGATTCTCGAGAATCCCTCCTATACCAAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010587.1-666s1c1
Sequence:CCGGGCTGAAATACAGGCAGTTATTCTCGAGAATAACTGCCTGTATTTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010587.1-1913s1c1
Sequence:CCGGGCCTGGAGTTAGAGAAGCAAACTCGAGTTTGCTTCTCTAACTCCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010587.1-106s1c1
Sequence:CCGGGCGGGATTTATTACTGGTGATCTCGAGATCACCAGTAATAAATCCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010587.1-4094s1c1
Sequence:CCGGCCAGCTTTATACTGAAGCCTACTCGAGTAGGCTTCAGTATAAAGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010587.1-4498s1c1
Sequence:CCGGCCCAAATCTAACCTTCAGTATCTCGAGATACTGAAGGTTAGATTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010587
VALIDATED
ITSN1 MISSION shRNA Lentiviral Transduction Particles
intersectin 1 (SH3 domain protein)
Mouse
19 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010587.2-4388s21c1
Sequence:GTACCGGCAAGATACCCGCTGATCATTACTCGAGTAATGATCAGCGGGTATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010587.2-356s21c1
Sequence:CCGGTGAAGCCGATAGCGGGATTTACTCGAGTAAATCCCGCTATCGGCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010587.2-5789s21c1
Sequence:CCGGTAGACTACTTGGCCTATAATACTCGAGTATTATAGGCCAAGTAGTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010587.2-1896s21c1
Sequence:CCGGGATACTCAGTGACCAGTTAAACTCGAGTTTAACTGGTCACTGAGTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010587.2-3395s21c1
Sequence:CCGGCTAACTATGTGAGGCTTAAAGCTCGAGCTTTAAGCCTCACATAGTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010587.2-1099s21c1
Sequence:CCGGATCCTAGCTATGCACCTAATTCTCGAGAATTAGGTGCATAGCTAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010587.2-5898s21c1
Sequence:GTACCGGAGCAGACACCAACGTACTTAACTCGAGTTAAGTACGTTGGTGTCTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010587.2-5522s21c1
Sequence:GTACCGGTAGGAGTCGTTCTCGACAATCCTCGAGGATTGTCGAGAACGACTCCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010587.2-5140s21c1
Sequence:GTACCGGACAATCCAGGACACGCTAAACCTCGAGGTTTAGCGTGTCCTGGATTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010587.1-729s1c1
Sequence:CCGGCCAGGCAAGAACTATTCTCATCTCGAGATGAGAATAGTTCTTGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010587.1-194s1c1
Sequence:CCGGCGGACATGAATAACGATGGAACTCGAGTTCCATCGTTATTCATGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010587.1-1547s1c1
Sequence:CCGGGAGAGCTAAGAATTGCTGAAACTCGAGTTTCAGCAATTCTTAGCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010587.1-4499s1c1
Sequence:CCGGCCAAATCTAACCTTCAGTATACTCGAGTATACTGAAGGTTAGATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010587.1-340s1c1
Sequence:CCGGGCATTTGGTATAGGAGGGATTCTCGAGAATCCCTCCTATACCAAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010587.1-666s1c1
Sequence:CCGGGCTGAAATACAGGCAGTTATTCTCGAGAATAACTGCCTGTATTTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010587.1-1913s1c1
Sequence:CCGGGCCTGGAGTTAGAGAAGCAAACTCGAGTTTGCTTCTCTAACTCCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010587.1-106s1c1
Sequence:CCGGGCGGGATTTATTACTGGTGATCTCGAGATCACCAGTAATAAATCCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010587.1-4094s1c1
Sequence:CCGGCCAGCTTTATACTGAAGCCTACTCGAGTAGGCTTCAGTATAAAGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010587.1-4498s1c1
Sequence:CCGGCCCAAATCTAACCTTCAGTATCTCGAGATACTGAAGGTTAGATTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)