EMAIL THIS PAGE TO A FRIEND

ITSN2

intersectin 2

151 Gene Product Result for
Synonyms: PRO2015 SH3D1B SH3P18 SWA SWAP
Gene ID:
Human(50618) Summary: This gene encodes a cytoplasmic protein which contains SH3 domains. This protein is a member of a family of proteins involved in clathrin-mediated endocytosis. Intersectin 2 is thought to regulate the formation of clathrin-coated vesicles and also may function in the induction of T cell antigen receptor (TCR) endocytosis. Alternatively spliced transcript variants have been found for this gene that encode three distinct isoforms. Additional variants have been found but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(20403) intersectin 2
Rat(313934) intersectin 2
sheep(101108644) intersectin 2
chicken(421979) intersectin 2
domestic cat(101095168) intersectin 2
cow(521706) intersectin 2
dog(475683) intersectin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA036475 Anti-ITSN2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019595 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019595 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019595 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011365 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011365 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011365 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006277 Rosetta Predictions human pricing
NM_019595 Rosetta Predictions human pricing
NM_147152 Rosetta Predictions human pricing
XM_001067157 Rosetta Predictions rat pricing
XM_001067202 Rosetta Predictions rat pricing
XM_001067254 Rosetta Predictions rat pricing
XM_233945 Rosetta Predictions rat pricing
NM_011365 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006277 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091435 predicted 1869
2 SASI_Hs01_00091436 predicted 824
3 SASI_Hs02_00341249 predicted 754
4 SASI_Hs01_00091438 predicted 1510
5 SASI_Hs01_00091439 predicted 331
6 SASI_Hs01_00091440 predicted 1300
7 SASI_Hs01_00091441 predicted 2723
8 SASI_Hs02_00341250 predicted 1722
9 SASI_Hs01_00091443 predicted 465
10 SASI_Hs01_00091444 predicted 3085
11 SASI_Hs01_00091437 predicted 3693
12 SASI_Hs01_00091442 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019595 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082020 predicted 1865
2 SASI_Hs01_00082021 predicted 829
3 SASI_Hs02_00352794 predicted 757
4 SASI_Hs01_00082023 predicted 1505
5 SASI_Hs01_00082024 predicted 330
6 SASI_Hs01_00082025 predicted 1294
7 SASI_Hs01_00082026 predicted 2639
8 SASI_Hs02_00352795 predicted 1723
9 SASI_Hs01_00082027 predicted 457
10 SASI_Hs01_00082028 predicted 3008
11 SASI_Hs01_00082022 predicted 3611
12 SASI_Hs01_00082029 predicted 359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147152 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096894 predicted 1870
2 SASI_Hs01_00096895 predicted 832
3 SASI_Hs02_00365486 predicted 748
4 SASI_Hs01_00096897 predicted 1504
5 SASI_Hs01_00096898 predicted 330
6 SASI_Hs01_00096899 predicted 1301
7 SASI_Hs01_00096900 predicted 2718
8 SASI_Hs02_00365487 predicted 1720
9 SASI_Hs01_00096902 predicted 463
10 SASI_Hs01_00096903 predicted 3087
11 SASI_Hs01_00096896 predicted 3688
12 SASI_Hs01_00096901 predicted 769
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067157 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00320047 predicted 1162
2 SASI_Rn02_00320048 predicted 578
3 SASI_Rn02_00320049 predicted 1417
4 SASI_Rn02_00320050 predicted 3283
5 SASI_Rn02_00320051 predicted 840
6 SASI_Rn02_00320052 predicted 1780
7 SASI_Rn02_00320053 predicted 4722
8 SASI_Rn02_00320054 predicted 280
9 SASI_Rn02_00320055 predicted 1070
10 SASI_Rn02_00320056 predicted 655
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067202 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00320211 predicted 1166
2 SASI_Rn02_00320212 predicted 581
3 SASI_Rn02_00320213 predicted 1413
4 SASI_Rn02_00320214 predicted 3205
5 SASI_Rn02_00320215 predicted 841
6 SASI_Rn02_00320216 predicted 1774
7 SASI_Rn02_00320217 predicted 4640
8 SASI_Rn02_00320218 predicted 280
9 SASI_Rn02_00320219 predicted 1061
10 SASI_Rn02_00320220 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067254 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00320396 predicted 1162
2 SASI_Rn02_00320397 predicted 582
3 SASI_Rn02_00320398 predicted 1421
4 SASI_Rn02_00320399 predicted 3157
5 SASI_Rn02_00320400 predicted 837
6 SASI_Rn02_00320401 predicted 1781
7 SASI_Rn02_00320402 predicted 4599
8 SASI_Rn02_00320403 predicted 287
9 SASI_Rn02_00320404 predicted 1067
10 SASI_Rn02_00320405 predicted 655
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233945 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388140 predicted 1160
2 SASI_Rn02_00388141 predicted 577
3 SASI_Rn02_00388142 predicted 1419
4 SASI_Rn02_00388143 predicted 3160
5 SASI_Rn02_00388144 predicted 837
6 SASI_Rn02_00388145 predicted 1783
7 SASI_Rn02_00388146 predicted 280
8 SASI_Rn02_00388147 predicted 4603
9 SASI_Rn02_00388148 predicted 1062
10 SASI_Rn02_00388149 predicted 655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011365 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118812 predicted 1929
2 SASI_Mm01_00118814 predicted 345
3 SASI_Mm02_00320525 predicted 2974
4 SASI_Mm01_00118815 predicted 2682
5 SASI_Mm02_00320526 predicted 1073
6 SASI_Mm01_00118816 predicted 620
7 SASI_Mm02_00320527 predicted 4624
8 SASI_Mm01_00118818 predicted 4784
9 SASI_Mm01_00118819 predicted 482
10 SASI_Mm01_00118821 predicted 3269
11 SASI_Mm01_00118813 predicted 785
12 SASI_Mm01_00118817 predicted 321
13 SASI_Mm01_00118820 predicted 3881
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019595
VALIDATED
ITSN2 MISSION shRNA Bacterial Glycerol Stock
intersectin 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019595.x-5811s1c1
Sequence:CCGGGTCTGGAGTATAAGTGGGAAACTCGAGTTTCCCACTTATACTCCAGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019595.x-1611s1c1
Sequence:CCGGGTCGCTTAGAATGGGAGAGAACTCGAGTTCTCTCCCATTCTAAGCGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_019595.x-2880s1c1
Sequence:CCGGCCTGGACTGCAAAGAAAGATACTCGAGTATCTTTCTTTGCAGTCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019595.x-1415s1c1
Sequence:CCGGGCAGAACGTAAAGCCCAGAAACTCGAGTTTCTGGGCTTTACGTTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019595.x-4725s1c1
Sequence:CCGGCCCTCCGAACAGACAACATTACTCGAGTAATGTTGTCTGTTCGGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019595.3-2900s21c1
Sequence:CCGGCCTGGACTGCAAAGAAAGATACTCGAGTATCTTTCTTTGCAGTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019595.3-5831s21c1
Sequence:CCGGGTCTGGAGTATAAGTGGGAAACTCGAGTTTCCCACTTATACTCCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019595.3-4745s21c1
Sequence:CCGGCCCTCCGAACAGACAACATTACTCGAGTAATGTTGTCTGTTCGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019595.3-1631s21c1
Sequence:CCGGGTCGCTTAGAATGGGAGAGAACTCGAGTTCTCTCCCATTCTAAGCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_019595.3-879s21c1
Sequence:GTACCGGAGCGCAGTCTCTGATTGATTTCTCGAGAAATCAATCAGAGACTGCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_019595.3-1435s21c1
Sequence:CCGGGCAGAACGTAAAGCCCAGAAACTCGAGTTTCTGGGCTTTACGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019595
VALIDATED
ITSN2 MISSION shRNA shRNA Plasmid DNA
intersectin 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019595.x-5811s1c1
Sequence:CCGGGTCTGGAGTATAAGTGGGAAACTCGAGTTTCCCACTTATACTCCAGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019595.x-1611s1c1
Sequence:CCGGGTCGCTTAGAATGGGAGAGAACTCGAGTTCTCTCCCATTCTAAGCGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_019595.x-2880s1c1
Sequence:CCGGCCTGGACTGCAAAGAAAGATACTCGAGTATCTTTCTTTGCAGTCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019595.x-1415s1c1
Sequence:CCGGGCAGAACGTAAAGCCCAGAAACTCGAGTTTCTGGGCTTTACGTTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019595.x-4725s1c1
Sequence:CCGGCCCTCCGAACAGACAACATTACTCGAGTAATGTTGTCTGTTCGGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019595.3-2900s21c1
Sequence:CCGGCCTGGACTGCAAAGAAAGATACTCGAGTATCTTTCTTTGCAGTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019595.3-5831s21c1
Sequence:CCGGGTCTGGAGTATAAGTGGGAAACTCGAGTTTCCCACTTATACTCCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019595.3-4745s21c1
Sequence:CCGGCCCTCCGAACAGACAACATTACTCGAGTAATGTTGTCTGTTCGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019595.3-1631s21c1
Sequence:CCGGGTCGCTTAGAATGGGAGAGAACTCGAGTTCTCTCCCATTCTAAGCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_019595.3-879s21c1
Sequence:GTACCGGAGCGCAGTCTCTGATTGATTTCTCGAGAAATCAATCAGAGACTGCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_019595.3-1435s21c1
Sequence:CCGGGCAGAACGTAAAGCCCAGAAACTCGAGTTTCTGGGCTTTACGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019595
VALIDATED
ITSN2 MISSION shRNA Lentiviral Transduction Particles
intersectin 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019595.x-5811s1c1
Sequence:CCGGGTCTGGAGTATAAGTGGGAAACTCGAGTTTCCCACTTATACTCCAGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019595.x-1611s1c1
Sequence:CCGGGTCGCTTAGAATGGGAGAGAACTCGAGTTCTCTCCCATTCTAAGCGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_019595.x-2880s1c1
Sequence:CCGGCCTGGACTGCAAAGAAAGATACTCGAGTATCTTTCTTTGCAGTCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019595.x-1415s1c1
Sequence:CCGGGCAGAACGTAAAGCCCAGAAACTCGAGTTTCTGGGCTTTACGTTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019595.x-4725s1c1
Sequence:CCGGCCCTCCGAACAGACAACATTACTCGAGTAATGTTGTCTGTTCGGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019595.3-2900s21c1
Sequence:CCGGCCTGGACTGCAAAGAAAGATACTCGAGTATCTTTCTTTGCAGTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019595.3-5831s21c1
Sequence:CCGGGTCTGGAGTATAAGTGGGAAACTCGAGTTTCCCACTTATACTCCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019595.3-4745s21c1
Sequence:CCGGCCCTCCGAACAGACAACATTACTCGAGTAATGTTGTCTGTTCGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019595.3-1631s21c1
Sequence:CCGGGTCGCTTAGAATGGGAGAGAACTCGAGTTCTCTCCCATTCTAAGCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_019595.3-879s21c1
Sequence:GTACCGGAGCGCAGTCTCTGATTGATTTCTCGAGAAATCAATCAGAGACTGCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_019595.3-1435s21c1
Sequence:CCGGGCAGAACGTAAAGCCCAGAAACTCGAGTTTCTGGGCTTTACGTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011365
VALIDATED
ITSN2 MISSION shRNA Bacterial Glycerol Stock
intersectin 2
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011365.2-3361s21c1
Sequence:CCGGTTGCGCCAGGACAGTTAATATCTCGAGATATTAACTGTCCTGGCGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111750    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011365.2-5274s1c1
Sequence:CCGGGCTGGGTCTAAAGACAGATTTCTCGAGAAATCTGTCTTTAGACCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011365.2-1924s21c1
Sequence:CCGGTCCCTGAGAAGCAGCTATTAACTCGAGTTAATAGCTGCTTCTCAGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011365.2-3302s21c1
Sequence:CCGGACCCGAGATCGCTCAAGTAACCTCGAGGTTACTTGAGCGATCTCGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011365.2-881s21c1
Sequence:CCGGGGCCCAGTCTCTGATTGATTTCTCGAGAAATCAATCAGAGACTGGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011365.2-3311s1c1
Sequence:CCGGCGCTCAAGTAACTTCAGCATACTCGAGTATGCTGAAGTTACTTGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011365.2-1853s1c1
Sequence:CCGGCCTGGAAATTATGGAAATCAACTCGAGTTGATTTCCATAATTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011365.2-1780s1c1
Sequence:CCGGGCAGACTACAAGATGTCCAAACTCGAGTTTGGACATCTTGTAGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011365.2-575s1c1
Sequence:CCGGCCCTATGTTCTCTCCACTAATCTCGAGATTAGTGGAGAGAACATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011365.2-3585s21c1
Sequence:CCGGTCCAAAGGACAGCTGATTAATCTCGAGATTAATCAGCTGTCCTTTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011365.2-1095s21c1
Sequence:CCGGCAAACTCAGCTAGCTACTATTCTCGAGAATAGTAGCTAGCTGAGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011365.2-293s21c1
Sequence:CCGGGCCAAATATGTGGGCTATTACCTCGAGGTAATAGCCCACATATTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328997    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011365.2-5375s21c1
Sequence:CCGGCTAAATTGCTAGCAATCTATGCTCGAGCATAGATTGCTAGCAATTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011365.2-5729s21c1
Sequence:CCGGTCTGACTAGATATTATCATTCCTCGAGGAATGATAATATCTAGTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011365
VALIDATED
ITSN2 MISSION shRNA shRNA Plasmid DNA
intersectin 2
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011365.2-3361s21c1
Sequence:CCGGTTGCGCCAGGACAGTTAATATCTCGAGATATTAACTGTCCTGGCGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111750    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011365.2-5274s1c1
Sequence:CCGGGCTGGGTCTAAAGACAGATTTCTCGAGAAATCTGTCTTTAGACCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011365.2-1924s21c1
Sequence:CCGGTCCCTGAGAAGCAGCTATTAACTCGAGTTAATAGCTGCTTCTCAGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011365.2-3302s21c1
Sequence:CCGGACCCGAGATCGCTCAAGTAACCTCGAGGTTACTTGAGCGATCTCGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011365.2-881s21c1
Sequence:CCGGGGCCCAGTCTCTGATTGATTTCTCGAGAAATCAATCAGAGACTGGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011365.2-3311s1c1
Sequence:CCGGCGCTCAAGTAACTTCAGCATACTCGAGTATGCTGAAGTTACTTGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011365.2-1853s1c1
Sequence:CCGGCCTGGAAATTATGGAAATCAACTCGAGTTGATTTCCATAATTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011365.2-1780s1c1
Sequence:CCGGGCAGACTACAAGATGTCCAAACTCGAGTTTGGACATCTTGTAGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011365.2-575s1c1
Sequence:CCGGCCCTATGTTCTCTCCACTAATCTCGAGATTAGTGGAGAGAACATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011365.2-3585s21c1
Sequence:CCGGTCCAAAGGACAGCTGATTAATCTCGAGATTAATCAGCTGTCCTTTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011365.2-1095s21c1
Sequence:CCGGCAAACTCAGCTAGCTACTATTCTCGAGAATAGTAGCTAGCTGAGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011365.2-293s21c1
Sequence:CCGGGCCAAATATGTGGGCTATTACCTCGAGGTAATAGCCCACATATTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328997    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011365.2-5375s21c1
Sequence:CCGGCTAAATTGCTAGCAATCTATGCTCGAGCATAGATTGCTAGCAATTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011365.2-5729s21c1
Sequence:CCGGTCTGACTAGATATTATCATTCCTCGAGGAATGATAATATCTAGTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011365
VALIDATED
ITSN2 MISSION shRNA Lentiviral Transduction Particles
intersectin 2
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011365.2-3361s21c1
Sequence:CCGGTTGCGCCAGGACAGTTAATATCTCGAGATATTAACTGTCCTGGCGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111750    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011365.2-5274s1c1
Sequence:CCGGGCTGGGTCTAAAGACAGATTTCTCGAGAAATCTGTCTTTAGACCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011365.2-1924s21c1
Sequence:CCGGTCCCTGAGAAGCAGCTATTAACTCGAGTTAATAGCTGCTTCTCAGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011365.2-3302s21c1
Sequence:CCGGACCCGAGATCGCTCAAGTAACCTCGAGGTTACTTGAGCGATCTCGGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011365.2-881s21c1
Sequence:CCGGGGCCCAGTCTCTGATTGATTTCTCGAGAAATCAATCAGAGACTGGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011365.2-3311s1c1
Sequence:CCGGCGCTCAAGTAACTTCAGCATACTCGAGTATGCTGAAGTTACTTGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011365.2-1853s1c1
Sequence:CCGGCCTGGAAATTATGGAAATCAACTCGAGTTGATTTCCATAATTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011365.2-1780s1c1
Sequence:CCGGGCAGACTACAAGATGTCCAAACTCGAGTTTGGACATCTTGTAGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011365.2-575s1c1
Sequence:CCGGCCCTATGTTCTCTCCACTAATCTCGAGATTAGTGGAGAGAACATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011365.2-3585s21c1
Sequence:CCGGTCCAAAGGACAGCTGATTAATCTCGAGATTAATCAGCTGTCCTTTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011365.2-1095s21c1
Sequence:CCGGCAAACTCAGCTAGCTACTATTCTCGAGAATAGTAGCTAGCTGAGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011365.2-293s21c1
Sequence:CCGGGCCAAATATGTGGGCTATTACCTCGAGGTAATAGCCCACATATTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328997    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011365.2-5375s21c1
Sequence:CCGGCTAAATTGCTAGCAATCTATGCTCGAGCATAGATTGCTAGCAATTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011365.2-5729s21c1
Sequence:CCGGTCTGACTAGATATTATCATTCCTCGAGGAATGATAATATCTAGTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)