EMAIL THIS PAGE TO A FRIEND

IVD

isovaleryl-CoA dehydrogenase

59 Gene Product Result for
Synonyms: ACAD2
UniProtKB ID: P26440, B2RCV5, B3KVI7, Q96AF6
Gene ID:
Human(3712) Summary: Isovaleryl-CoA dehydrogenase (IVD) is a mitochondrial matrix enzyme that catalyzes the third step in leucine catabolism. The genetic deficiency of IVD results in an accumulation of isovaleric acid, which is toxic to the central nervous system and leads to isovaleric acidemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
Mouse(56357) isovaleryl coenzyme A dehydrogenase
Rat(24513) isovaleryl-CoA dehydrogenase
sheep(101113856) isovaleryl-CoA dehydrogenase
Domestic Rabbit(100357511) isovaleryl-CoA dehydrogenase
domestic guinea pig(100714971) isovaleryl-CoA dehydrogenase
naked mole-rat(101710885) isovaleryl-CoA dehydrogenase
Zebrafish(368775) isovaleryl Coenzyme A dehydrogenase
chicken(423011) isovaleryl-CoA dehydrogenase
dog(478259) isovaleryl-CoA dehydrogenase
Thale Cress(823668) isovaleryl-CoA-dehydrogenase
domestic cat(101089942) isovaleryl-CoA dehydrogenase
cow(510440) isovaleryl-CoA dehydrogenase
Horse(100057233) isovaleryl-CoA dehydrogenase
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002225 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002225 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002225 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019826 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019826 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019826 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002225 Rosetta Predictions human pricing
NM_012592 Rosetta Predictions rat pricing
NM_019826 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002225 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203574 predicted 865
2 SASI_Hs01_00203575 predicted 1095
3 SASI_Hs01_00203577 predicted 448
4 SASI_Hs01_00203578 predicted 1125
5 SASI_Hs01_00203579 predicted 552
6 SASI_Hs01_00203580 predicted 792
7 SASI_Hs01_00203581 predicted 1036
8 SASI_Hs01_00203582 predicted 1077
9 SASI_Hs01_00203583 predicted 1584
10 SASI_Hs02_00333457 predicted 911
11 SASI_Hs01_00203576 predicted 857
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012592 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100836 predicted 1008
2 SASI_Rn01_00100837 predicted 918
3 SASI_Rn02_00259740 predicted 1056
4 SASI_Rn01_00100838 predicted 1131
5 SASI_Rn01_00100839 predicted 410
6 SASI_Rn01_00100840 predicted 783
7 SASI_Rn01_00100841 predicted 610
8 SASI_Rn01_00100842 predicted 549
9 SASI_Rn01_00100843 predicted 698
10 SASI_Rn01_00100844 predicted 463
11 SASI_Rn01_00100845 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019826 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077779 predicted 1252
2 SASI_Mm01_00077781 predicted 1147
3 SASI_Mm01_00077783 predicted 1244
4 SASI_Mm01_00077784 predicted 569
5 SASI_Mm01_00077785 predicted 991
6 SASI_Mm01_00077786 predicted 624
7 SASI_Mm01_00077787 predicted 364
8 SASI_Mm02_00325119 predicted 520
9 SASI_Mm02_00325120 predicted 687
10 SASI_Mm02_00325121 predicted 633
11 SASI_Mm01_00077778 predicted 939
12 SASI_Mm01_00077780 predicted 336
13 SASI_Mm01_00077782 predicted 732
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002225
VALIDATED
IVD MISSION shRNA Bacterial Glycerol Stock
isovaleryl-CoA dehydrogenase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002225.3-1009s21c1
Sequence:CCGGCACAGCCTTCATTGTGGAGAACTCGAGTTCTCCACAATGAAGGCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330976    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002225.3-1836s21c1
Sequence:CCGGGACTCAGCAGGAAGCATATTGCTCGAGCAATATGCTTCCTGCTGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002225.3-1529s21c1
Sequence:CCGGGATGCCAAGCTGTATGAGATACTCGAGTATCTCATACAGCTTGGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002225.3-1085s21c1
Sequence:CCGGTCTAACACCTGTGAGCTAATCCTCGAGGATTAGCTCACAGGTGTTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002225.3-1350s21c1
Sequence:CCGGGTCGGCAGTATGTCTACAATGCTCGAGCATTGTAGACATACTGCCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_002225.2-1009s1c1
Sequence:CCGGCACAGCCTTCATTGTGGAGAACTCGAGTTCTCCACAATGAAGGCTGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_002225.2-449s1c1
Sequence:CCGGGACGATGCAATCAATGGGCTACTCGAGTAGCCCATTGATTGCATCGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002225.2-560s1c1
Sequence:CCGGGAGTTCAAGAACCTGCGAGAACTCGAGTTCTCGCAGGTTCTTGAACTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_002225.2-1529s1c1
Sequence:CCGGGATGCCAAGCTGTATGAGATACTCGAGTATCTCATACAGCTTGGCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_002225.2-849s1c1
Sequence:CCGGCAGGCTCTGATGTTGTCTCTACTCGAGTAGAGACAACATCAGAGCCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002225
VALIDATED
IVD MISSION shRNA shRNA Plasmid DNA
isovaleryl-CoA dehydrogenase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002225.3-1009s21c1
Sequence:CCGGCACAGCCTTCATTGTGGAGAACTCGAGTTCTCCACAATGAAGGCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330976    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002225.3-1836s21c1
Sequence:CCGGGACTCAGCAGGAAGCATATTGCTCGAGCAATATGCTTCCTGCTGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002225.3-1529s21c1
Sequence:CCGGGATGCCAAGCTGTATGAGATACTCGAGTATCTCATACAGCTTGGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002225.3-1085s21c1
Sequence:CCGGTCTAACACCTGTGAGCTAATCCTCGAGGATTAGCTCACAGGTGTTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002225.3-1350s21c1
Sequence:CCGGGTCGGCAGTATGTCTACAATGCTCGAGCATTGTAGACATACTGCCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_002225.2-1009s1c1
Sequence:CCGGCACAGCCTTCATTGTGGAGAACTCGAGTTCTCCACAATGAAGGCTGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_002225.2-449s1c1
Sequence:CCGGGACGATGCAATCAATGGGCTACTCGAGTAGCCCATTGATTGCATCGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002225.2-560s1c1
Sequence:CCGGGAGTTCAAGAACCTGCGAGAACTCGAGTTCTCGCAGGTTCTTGAACTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_002225.2-1529s1c1
Sequence:CCGGGATGCCAAGCTGTATGAGATACTCGAGTATCTCATACAGCTTGGCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_002225.2-849s1c1
Sequence:CCGGCAGGCTCTGATGTTGTCTCTACTCGAGTAGAGACAACATCAGAGCCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002225
VALIDATED
IVD MISSION shRNA Lentiviral Transduction Particles
isovaleryl-CoA dehydrogenase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002225.3-1009s21c1
Sequence:CCGGCACAGCCTTCATTGTGGAGAACTCGAGTTCTCCACAATGAAGGCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330976    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002225.3-1836s21c1
Sequence:CCGGGACTCAGCAGGAAGCATATTGCTCGAGCAATATGCTTCCTGCTGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002225.3-1529s21c1
Sequence:CCGGGATGCCAAGCTGTATGAGATACTCGAGTATCTCATACAGCTTGGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002225.3-1085s21c1
Sequence:CCGGTCTAACACCTGTGAGCTAATCCTCGAGGATTAGCTCACAGGTGTTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002225.3-1350s21c1
Sequence:CCGGGTCGGCAGTATGTCTACAATGCTCGAGCATTGTAGACATACTGCCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_002225.2-1009s1c1
Sequence:CCGGCACAGCCTTCATTGTGGAGAACTCGAGTTCTCCACAATGAAGGCTGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_002225.2-449s1c1
Sequence:CCGGGACGATGCAATCAATGGGCTACTCGAGTAGCCCATTGATTGCATCGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002225.2-560s1c1
Sequence:CCGGGAGTTCAAGAACCTGCGAGAACTCGAGTTCTCGCAGGTTCTTGAACTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_002225.2-1529s1c1
Sequence:CCGGGATGCCAAGCTGTATGAGATACTCGAGTATCTCATACAGCTTGGCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_002225.2-849s1c1
Sequence:CCGGCAGGCTCTGATGTTGTCTCTACTCGAGTAGAGACAACATCAGAGCCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019826
VALIDATED
IVD MISSION shRNA Bacterial Glycerol Stock
isovaleryl-CoA dehydrogenase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019826.3-1198s21c1
Sequence:CCGGCGCTTTCTACGAGATGCCAAACTCGAGTTTGGCATCTCGTAGAAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019826.3-454s21c1
Sequence:CCGGGCACAGAAAGAGAAATACCTTCTCGAGAAGGTATTTCTCTTTCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019826.3-168s21c1
Sequence:CCGGGCTTCGTCATACTATATCTAACTCGAGTTAGATATAGTATGACGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019826.3-628s21c1
Sequence:CCGGGCTGATATCCTAGTCGTGTATCTCGAGATACACGACTAGGATATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019826.3-1269s21c1
Sequence:CCGGCCGAGCTTTCAATGCAGACTTCTCGAGAAGTCTGCATTGAAAGCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019826.2-1269s1c1
Sequence:CCGGCCGAGCTTTCAATGCAGACTTCTCGAGAAGTCTGCATTGAAAGCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019826.2-628s1c1
Sequence:CCGGGCTGATATCCTAGTCGTGTATCTCGAGATACACGACTAGGATATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019826.2-454s1c1
Sequence:CCGGGCACAGAAAGAGAAATACCTTCTCGAGAAGGTATTTCTCTTTCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019826.2-1198s1c1
Sequence:CCGGCGCTTTCTACGAGATGCCAAACTCGAGTTTGGCATCTCGTAGAAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019826.2-168s1c1
Sequence:CCGGGCTTCGTCATACTATATCTAACTCGAGTTAGATATAGTATGACGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019826
VALIDATED
IVD MISSION shRNA shRNA Plasmid DNA
isovaleryl-CoA dehydrogenase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019826.3-1198s21c1
Sequence:CCGGCGCTTTCTACGAGATGCCAAACTCGAGTTTGGCATCTCGTAGAAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019826.3-454s21c1
Sequence:CCGGGCACAGAAAGAGAAATACCTTCTCGAGAAGGTATTTCTCTTTCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019826.3-168s21c1
Sequence:CCGGGCTTCGTCATACTATATCTAACTCGAGTTAGATATAGTATGACGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019826.3-628s21c1
Sequence:CCGGGCTGATATCCTAGTCGTGTATCTCGAGATACACGACTAGGATATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019826.3-1269s21c1
Sequence:CCGGCCGAGCTTTCAATGCAGACTTCTCGAGAAGTCTGCATTGAAAGCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019826.2-1269s1c1
Sequence:CCGGCCGAGCTTTCAATGCAGACTTCTCGAGAAGTCTGCATTGAAAGCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019826.2-628s1c1
Sequence:CCGGGCTGATATCCTAGTCGTGTATCTCGAGATACACGACTAGGATATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019826.2-454s1c1
Sequence:CCGGGCACAGAAAGAGAAATACCTTCTCGAGAAGGTATTTCTCTTTCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019826.2-1198s1c1
Sequence:CCGGCGCTTTCTACGAGATGCCAAACTCGAGTTTGGCATCTCGTAGAAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019826.2-168s1c1
Sequence:CCGGGCTTCGTCATACTATATCTAACTCGAGTTAGATATAGTATGACGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019826
VALIDATED
IVD MISSION shRNA Lentiviral Transduction Particles
isovaleryl-CoA dehydrogenase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019826.3-1198s21c1
Sequence:CCGGCGCTTTCTACGAGATGCCAAACTCGAGTTTGGCATCTCGTAGAAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019826.3-454s21c1
Sequence:CCGGGCACAGAAAGAGAAATACCTTCTCGAGAAGGTATTTCTCTTTCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019826.3-168s21c1
Sequence:CCGGGCTTCGTCATACTATATCTAACTCGAGTTAGATATAGTATGACGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019826.3-628s21c1
Sequence:CCGGGCTGATATCCTAGTCGTGTATCTCGAGATACACGACTAGGATATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019826.3-1269s21c1
Sequence:CCGGCCGAGCTTTCAATGCAGACTTCTCGAGAAGTCTGCATTGAAAGCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019826.2-1269s1c1
Sequence:CCGGCCGAGCTTTCAATGCAGACTTCTCGAGAAGTCTGCATTGAAAGCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019826.2-628s1c1
Sequence:CCGGGCTGATATCCTAGTCGTGTATCTCGAGATACACGACTAGGATATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019826.2-454s1c1
Sequence:CCGGGCACAGAAAGAGAAATACCTTCTCGAGAAGGTATTTCTCTTTCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019826.2-1198s1c1
Sequence:CCGGCGCTTTCTACGAGATGCCAAACTCGAGTTTGGCATCTCGTAGAAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019826.2-168s1c1
Sequence:CCGGGCTTCGTCATACTATATCTAACTCGAGTTAGATATAGTATGACGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)