EMAIL THIS PAGE TO A FRIEND

IVL

involucrin

74 Gene Product Result for
UniProtKB ID: P07476, Q5T7P4
Gene ID:
Human(3713) Summary: Involucrin, a component of the keratinocyte crosslinked envelope, is found in the cytoplasm and crosslinked to membrane proteins by transglutaminase. This gene is mapped to 1q21, among calpactin I light chain, trichohyalin, profillaggrin, loricrin, and calcyclin. [provided by RefSeq, Jul 2008]
Mouse(16447) involucrin
Rat(60583) involucrin
dog(609423) involucrin
cow(280830) involucrin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501594 Anti-Involucrin antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry, western blot pricing
AV48675 Anti-IVL antibody produced in rabbit affinity isolated antibody human
western blot pricing
HPA055211 Anti-IVL antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry pricing
I9018 Monoclonal Anti-Involucrin antibody produced in mouse clone SY5, ascites fluid owl monkey, canine, gorilla, pig, human
ELISA, immunocytochemistry, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005547 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005547 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005547 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008412 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008412 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008412 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005547 Rosetta Predictions human pricing
NM_022195 Rosetta Predictions rat pricing
NM_008412 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005547 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022172 predicted 1886
2 SASI_Hs01_00022173 predicted 1886
3 SASI_Hs01_00022174 predicted 1893
4 SASI_Hs01_00022175 predicted 1882
5 SASI_Hs01_00022176 predicted 1876
6 SASI_Hs01_00022177 predicted 1883
7 SASI_Hs01_00022178 predicted 1875
8 SASI_Hs01_00022179 predicted 1893
9 SASI_Hs01_00022180 predicted 1911
10 SASI_Hs01_00022181 predicted 435
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022195 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065192 predicted 1129
2 SASI_Rn01_00065193 predicted 1364
3 SASI_Rn01_00065194 predicted 957
4 SASI_Rn01_00065195 predicted 1199
5 SASI_Rn01_00065196 predicted 999
6 SASI_Rn01_00065197 predicted 799
7 SASI_Rn01_00065198 predicted 1217
8 SASI_Rn02_00262939 predicted 367
9 SASI_Rn01_00065199 predicted 666
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008412 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114132 predicted 1314
2 SASI_Mm01_00114133 predicted 1302
3 SASI_Mm01_00114134 predicted 1401
4 SASI_Mm02_00313860 predicted 751
5 SASI_Mm01_00114135 predicted 1186
6 SASI_Mm02_00313861 predicted 1243
7 SASI_Mm02_00313862 predicted 1294
8 SASI_Mm01_00114136 predicted 1438
9 SASI_Mm01_00114137 predicted 1209
10 SASI_Mm01_00114138 predicted 968
11 SASI_Mm01_00114131 predicted 1399
12 SASI_Mm01_00114139 predicted 777
13 SASI_Mm01_00114140 predicted 1463
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005547
IVL MISSION shRNA Bacterial Glycerol Stock
involucrin
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005547.2-1825s1c1
Sequence:CCGGCCCTCAGATCGTCTCATACAACTCGAGTTGTATGAGACGATCTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005547.2-332s1c1
Sequence:CCGGGAGGAATATCAGAAAGCAGAACTCGAGTTCTGCTTTCTGATATTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005547.2-1723s1c1
Sequence:CCGGGCCCACAAAGGGAGAAGTATTCTCGAGAATACTTCTCCCTTTGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005547.2-1722s1c1
Sequence:CCGGTGCCCACAAAGGGAGAAGTATCTCGAGATACTTCTCCCTTTGTGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005547.2-127s1c1
Sequence:CCGGCAATACCCATCAGGAGCAAATCTCGAGATTTGCTCCTGATGGGTATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005547.2-1783s21c1
Sequence:CCGGGTGGCCACCCAAACATAAATACTCGAGTATTTATGTTTGGGTGGCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005547.2-2030s21c1
Sequence:CCGGTGAGGGACTATTGTTACTATACTCGAGTATAGTAACAATAGTCCCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005547
IVL MISSION shRNA shRNA Plasmid DNA
involucrin
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005547.2-1825s1c1
Sequence:CCGGCCCTCAGATCGTCTCATACAACTCGAGTTGTATGAGACGATCTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005547.2-332s1c1
Sequence:CCGGGAGGAATATCAGAAAGCAGAACTCGAGTTCTGCTTTCTGATATTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005547.2-1723s1c1
Sequence:CCGGGCCCACAAAGGGAGAAGTATTCTCGAGAATACTTCTCCCTTTGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005547.2-1722s1c1
Sequence:CCGGTGCCCACAAAGGGAGAAGTATCTCGAGATACTTCTCCCTTTGTGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005547.2-127s1c1
Sequence:CCGGCAATACCCATCAGGAGCAAATCTCGAGATTTGCTCCTGATGGGTATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005547.2-1783s21c1
Sequence:CCGGGTGGCCACCCAAACATAAATACTCGAGTATTTATGTTTGGGTGGCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005547.2-2030s21c1
Sequence:CCGGTGAGGGACTATTGTTACTATACTCGAGTATAGTAACAATAGTCCCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005547
IVL MISSION shRNA Lentiviral Transduction Particles
involucrin
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005547.2-1825s1c1
Sequence:CCGGCCCTCAGATCGTCTCATACAACTCGAGTTGTATGAGACGATCTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005547.2-332s1c1
Sequence:CCGGGAGGAATATCAGAAAGCAGAACTCGAGTTCTGCTTTCTGATATTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005547.2-1723s1c1
Sequence:CCGGGCCCACAAAGGGAGAAGTATTCTCGAGAATACTTCTCCCTTTGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005547.2-1722s1c1
Sequence:CCGGTGCCCACAAAGGGAGAAGTATCTCGAGATACTTCTCCCTTTGTGGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005547.2-127s1c1
Sequence:CCGGCAATACCCATCAGGAGCAAATCTCGAGATTTGCTCCTGATGGGTATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005547.2-1783s21c1
Sequence:CCGGGTGGCCACCCAAACATAAATACTCGAGTATTTATGTTTGGGTGGCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005547.2-2030s21c1
Sequence:CCGGTGAGGGACTATTGTTACTATACTCGAGTATAGTAACAATAGTCCCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008412
IVL MISSION shRNA Bacterial Glycerol Stock
involucrin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008412.1-938s1c1
Sequence:CCGGAGCCAGAACTGTACCTGAGAACTCGAGTTCTCAGGTACAGTTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008412.1-939s1c1
Sequence:CCGGGCCAGAACTGTACCTGAGAAACTCGAGTTTCTCAGGTACAGTTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008412.1-62s1c1
Sequence:CCGGCTGTGTGTTCTCCAGATCATACTCGAGTATGATCTGGAGAACACACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008412.1-142s1c1
Sequence:CCGGGAGATTCAAGAGAAGGGCTTTCTCGAGAAAGCCCTTCTCTTGAATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008412.1-1158s1c1
Sequence:CCGGGCCAGAATTACACCTAGGAAACTCGAGTTTCCTAGGTGTAATTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008412
IVL MISSION shRNA shRNA Plasmid DNA
involucrin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008412.1-938s1c1
Sequence:CCGGAGCCAGAACTGTACCTGAGAACTCGAGTTCTCAGGTACAGTTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008412.1-939s1c1
Sequence:CCGGGCCAGAACTGTACCTGAGAAACTCGAGTTTCTCAGGTACAGTTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008412.1-62s1c1
Sequence:CCGGCTGTGTGTTCTCCAGATCATACTCGAGTATGATCTGGAGAACACACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008412.1-142s1c1
Sequence:CCGGGAGATTCAAGAGAAGGGCTTTCTCGAGAAAGCCCTTCTCTTGAATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008412.1-1158s1c1
Sequence:CCGGGCCAGAATTACACCTAGGAAACTCGAGTTTCCTAGGTGTAATTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008412
IVL MISSION shRNA Lentiviral Transduction Particles
involucrin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008412.1-938s1c1
Sequence:CCGGAGCCAGAACTGTACCTGAGAACTCGAGTTCTCAGGTACAGTTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008412.1-939s1c1
Sequence:CCGGGCCAGAACTGTACCTGAGAAACTCGAGTTTCTCAGGTACAGTTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008412.1-62s1c1
Sequence:CCGGCTGTGTGTTCTCCAGATCATACTCGAGTATGATCTGGAGAACACACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008412.1-142s1c1
Sequence:CCGGGAGATTCAAGAGAAGGGCTTTCTCGAGAAAGCCCTTCTCTTGAATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008412.1-1158s1c1
Sequence:CCGGGCCAGAATTACACCTAGGAAACTCGAGTTTCCTAGGTGTAATTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)