EMAIL THIS PAGE TO A FRIEND

IVNS1ABP

influenza virus NS1A binding protein

134 Gene Product Result for
Synonyms: FLARA3 HSPC068 KLHL39 ND1 NS-1 NS1-BP NS1BP
Gene ID:
Mouse(117198) influenza virus NS1A binding protein
Rat(289089) influenza virus NS1A binding protein
sheep(101108935) influenza virus NS1A binding protein
domestic guinea pig(100719250) influenza virus NS1A binding protein
naked mole-rat(101707309) influenza virus NS1A binding protein
chicken(426862) influenza virus NS1A binding protein
cow(514940) influenza virus NS1A binding protein
domestic cat(101083392) influenza virus NS1A binding protein
dog(480043) influenza virus NS1A binding protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA003405 Anti-IVNS1ABP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_054102 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054102 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054102 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006469 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006469 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006469 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006469 Rosetta Predictions human pricing
NM_016389 Rosetta Predictions human pricing
NM_001047085 Rosetta Predictions rat pricing
NM_001039511 Rosetta Predictions mouse pricing
NM_001039512 Rosetta Predictions mouse pricing
NM_054102 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006469 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341638 predicted 1066
2 SASI_Hs02_00341639 predicted 1145
3 SASI_Hs01_00043713 predicted 884
4 SASI_Hs01_00043714 predicted 2492
5 SASI_Hs02_00341640 predicted 1129
6 SASI_Hs01_00043715 predicted 2586
7 SASI_Hs01_00043716 predicted 995
8 SASI_Hs01_00043717 predicted 1726
9 SASI_Hs01_00043718 predicted 1964
10 SASI_Hs01_00043719 predicted 1005
11 SASI_Hs01_00043710 predicted 637
12 SASI_Hs01_00043711 predicted 912
13 SASI_Hs01_00043712 predicted 1779
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016389 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239732 predicted 628
2 SASI_Hs01_00239733 predicted 1658
3 SASI_Hs01_00239734 predicted 912
4 SASI_Hs01_00239735 predicted 894
5 SASI_Hs01_00239736 predicted 709
6 SASI_Hs01_00239737 predicted 740
7 SASI_Hs01_00239738 predicted 973
8 SASI_Hs01_00239739 predicted 831
9 SASI_Hs01_00239740 predicted 917
10 SASI_Hs01_00239741 predicted 1000
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047085 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205784 predicted 513
2 SASI_Rn02_00205785 predicted 918
3 SASI_Rn02_00205786 predicted 970
4 SASI_Rn02_00205787 predicted 847
5 SASI_Rn02_00205788 predicted 741
6 SASI_Rn02_00205789 predicted 556
7 SASI_Rn02_00205790 predicted 1140
8 SASI_Rn02_00205791 predicted 961
9 SASI_Rn02_00205792 predicted 760
10 SASI_Rn02_00205793 predicted 888
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039511 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290097 predicted 784
2 SASI_Mm02_00290098 predicted 695
3 SASI_Mm02_00290099 predicted 505
4 SASI_Mm02_00290100 predicted 786
5 SASI_Mm02_00290101 predicted 687
6 SASI_Mm02_00290102 predicted 703
7 SASI_Mm02_00290103 predicted 588
8 SASI_Mm02_00290104 predicted 698
9 SASI_Mm02_00290105 predicted 724
10 SASI_Mm02_00290106 predicted 765
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039512 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025658 predicted 786
2 SASI_Mm01_00025659 predicted 700
3 SASI_Mm01_00025660 predicted 506
4 SASI_Mm01_00025661 predicted 786
5 SASI_Mm01_00025662 predicted 693
6 SASI_Mm01_00025663 predicted 697
7 SASI_Mm02_00290107 predicted 586
8 SASI_Mm01_00025665 predicted 702
9 SASI_Mm01_00025666 predicted 716
10 SASI_Mm01_00025667 predicted 769
11 SASI_Mm01_00025664 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054102 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182360 predicted 793
2 SASI_Mm01_00182361 predicted 694
3 SASI_Mm01_00182362 predicted 512
4 SASI_Mm01_00182363 predicted 787
5 SASI_Mm01_00182364 predicted 688
6 SASI_Mm01_00182365 predicted 701
7 SASI_Mm02_00338047 predicted 592
8 SASI_Mm01_00182367 predicted 696
9 SASI_Mm01_00182368 predicted 721
10 SASI_Mm01_00182369 predicted 764
11 SASI_Mm01_00182366 predicted 627
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054102
VALIDATED
IVNS1ABP MISSION shRNA Bacterial Glycerol Stock
influenza virus NS1A binding protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054102.2-792s21c1
Sequence:CCGGAGCTGATAAGGAATTAGTAAACTCGAGTTTACTAATTCCTTATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054102.2-1047s21c1
Sequence:CCGGGCTTGAAGATAATGTGTGCTTCTCGAGAAGCACACATTATCTTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054102.2-3202s21c1
Sequence:CCGGCCCAGGTTTGATGAGTTACTTCTCGAGAAGTAACTCATCAAACCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054102.2-965s21c1
Sequence:CCGGACGCTTATATTCAGGAGCATTCTCGAGAATGCTCCTGAATATAAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054102.1-3201s1c1
Sequence:CCGGCCCAGGTTTGATGAGTTACTTCTCGAGAAGTAACTCATCAAACCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054102.1-961s1c1
Sequence:CCGGACGCTTATATTCAGGAGCATTCTCGAGAATGCTCCTGAATATAAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054102.1-862s1c1
Sequence:CCGGGCGGAGATTATTTACTATCTACTCGAGTAGATAGTAAATAATCTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054102.1-1043s1c1
Sequence:CCGGGCTTGAAGATAATGTGTGCTTCTCGAGAAGCACACATTATCTTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054102.2-866s21c1
Sequence:CCGGGCGGAGATTATTTACTATCTACTCGAGTAGATAGTAAATAATCTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054102
VALIDATED
IVNS1ABP MISSION shRNA shRNA Plasmid DNA
influenza virus NS1A binding protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054102.2-792s21c1
Sequence:CCGGAGCTGATAAGGAATTAGTAAACTCGAGTTTACTAATTCCTTATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054102.2-1047s21c1
Sequence:CCGGGCTTGAAGATAATGTGTGCTTCTCGAGAAGCACACATTATCTTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054102.2-3202s21c1
Sequence:CCGGCCCAGGTTTGATGAGTTACTTCTCGAGAAGTAACTCATCAAACCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054102.2-965s21c1
Sequence:CCGGACGCTTATATTCAGGAGCATTCTCGAGAATGCTCCTGAATATAAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054102.1-3201s1c1
Sequence:CCGGCCCAGGTTTGATGAGTTACTTCTCGAGAAGTAACTCATCAAACCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054102.1-961s1c1
Sequence:CCGGACGCTTATATTCAGGAGCATTCTCGAGAATGCTCCTGAATATAAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054102.1-862s1c1
Sequence:CCGGGCGGAGATTATTTACTATCTACTCGAGTAGATAGTAAATAATCTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054102.1-1043s1c1
Sequence:CCGGGCTTGAAGATAATGTGTGCTTCTCGAGAAGCACACATTATCTTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054102.2-866s21c1
Sequence:CCGGGCGGAGATTATTTACTATCTACTCGAGTAGATAGTAAATAATCTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054102
VALIDATED
IVNS1ABP MISSION shRNA Lentiviral Transduction Particles
influenza virus NS1A binding protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054102.2-792s21c1
Sequence:CCGGAGCTGATAAGGAATTAGTAAACTCGAGTTTACTAATTCCTTATCAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000303205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054102.2-1047s21c1
Sequence:CCGGGCTTGAAGATAATGTGTGCTTCTCGAGAAGCACACATTATCTTCAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000303134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054102.2-3202s21c1
Sequence:CCGGCCCAGGTTTGATGAGTTACTTCTCGAGAAGTAACTCATCAAACCTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000303204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054102.2-965s21c1
Sequence:CCGGACGCTTATATTCAGGAGCATTCTCGAGAATGCTCCTGAATATAAGCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000108650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054102.1-3201s1c1
Sequence:CCGGCCCAGGTTTGATGAGTTACTTCTCGAGAAGTAACTCATCAAACCTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000108654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054102.1-961s1c1
Sequence:CCGGACGCTTATATTCAGGAGCATTCTCGAGAATGCTCCTGAATATAAGCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000108651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054102.1-862s1c1
Sequence:CCGGGCGGAGATTATTTACTATCTACTCGAGTAGATAGTAAATAATCTCCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000108653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054102.1-1043s1c1
Sequence:CCGGGCTTGAAGATAATGTGTGCTTCTCGAGAAGCACACATTATCTTCAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000315472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054102.2-866s21c1
Sequence:CCGGGCGGAGATTATTTACTATCTACTCGAGTAGATAGTAAATAATCTCCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006469
VALIDATED
IVNS1ABP MISSION shRNA Bacterial Glycerol Stock
influenza virus NS1A binding protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006469.4-781s21c1
Sequence:CCGGGCAGTCCCTATTTATTTGAAACTCGAGTTTCAAATAAATAGGGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006469.4-1022s21c1
Sequence:CCGGCTGCATCTCTTACCGAAATTTCTCGAGAAATTTCGGTAAGAGATGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006469.4-1839s21c1
Sequence:CCGGGCCCGATTTCAAATGGCTGTACTCGAGTACAGCCATTTGAAATCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006469.4-3039s21c1
Sequence:CCGGGCTTACATGCCTACCAATATTCTCGAGAATATTGGTAGGCATGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006469.4-826s21c1
Sequence:CCGGATGGAATTTCTCACGTTAAATCTCGAGATTTAACGTGAGAAATTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006469.2-713s1c1
Sequence:CCGGGCAGTCCCTATTTATTTGAAACTCGAGTTTCAAATAAATAGGGACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021114    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006469.2-2497s1c1
Sequence:CCGGCCTCTCAAACTAACAGGCTTACTCGAGTAAGCCTGTTAGTTTGAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006469.2-1119s1c1
Sequence:CCGGGCCCAGCAATGGCAAATTATACTCGAGTATAATTTGCCATTGCTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006469.2-1771s1c1
Sequence:CCGGGCCCGATTTCAAATGGCTGTACTCGAGTACAGCCATTTGAAATCGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006469
VALIDATED
IVNS1ABP MISSION shRNA shRNA Plasmid DNA
influenza virus NS1A binding protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006469.4-781s21c1
Sequence:CCGGGCAGTCCCTATTTATTTGAAACTCGAGTTTCAAATAAATAGGGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006469.4-1022s21c1
Sequence:CCGGCTGCATCTCTTACCGAAATTTCTCGAGAAATTTCGGTAAGAGATGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006469.4-1839s21c1
Sequence:CCGGGCCCGATTTCAAATGGCTGTACTCGAGTACAGCCATTTGAAATCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006469.4-3039s21c1
Sequence:CCGGGCTTACATGCCTACCAATATTCTCGAGAATATTGGTAGGCATGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006469.4-826s21c1
Sequence:CCGGATGGAATTTCTCACGTTAAATCTCGAGATTTAACGTGAGAAATTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006469.2-713s1c1
Sequence:CCGGGCAGTCCCTATTTATTTGAAACTCGAGTTTCAAATAAATAGGGACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021114    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006469.2-2497s1c1
Sequence:CCGGCCTCTCAAACTAACAGGCTTACTCGAGTAAGCCTGTTAGTTTGAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006469.2-1119s1c1
Sequence:CCGGGCCCAGCAATGGCAAATTATACTCGAGTATAATTTGCCATTGCTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006469.2-1771s1c1
Sequence:CCGGGCCCGATTTCAAATGGCTGTACTCGAGTACAGCCATTTGAAATCGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006469
VALIDATED
IVNS1ABP MISSION shRNA Lentiviral Transduction Particles
influenza virus NS1A binding protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006469.4-781s21c1
Sequence:CCGGGCAGTCCCTATTTATTTGAAACTCGAGTTTCAAATAAATAGGGACTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000274341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006469.4-1022s21c1
Sequence:CCGGCTGCATCTCTTACCGAAATTTCTCGAGAAATTTCGGTAAGAGATGCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000285183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006469.4-1839s21c1
Sequence:CCGGGCCCGATTTCAAATGGCTGTACTCGAGTACAGCCATTTGAAATCGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000285182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006469.4-3039s21c1
Sequence:CCGGGCTTACATGCCTACCAATATTCTCGAGAATATTGGTAGGCATGTAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000274280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006469.4-826s21c1
Sequence:CCGGATGGAATTTCTCACGTTAAATCTCGAGATTTAACGTGAGAAATTCCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000021116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006469.2-713s1c1
Sequence:CCGGGCAGTCCCTATTTATTTGAAACTCGAGTTTCAAATAAATAGGGACTGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000021114    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006469.2-2497s1c1
Sequence:CCGGCCTCTCAAACTAACAGGCTTACTCGAGTAAGCCTGTTAGTTTGAGAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000021117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006469.2-1119s1c1
Sequence:CCGGGCCCAGCAATGGCAAATTATACTCGAGTATAATTTGCCATTGCTGGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000021115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006469.2-1771s1c1
Sequence:CCGGGCCCGATTTCAAATGGCTGTACTCGAGTACAGCCATTTGAAATCGGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???