EMAIL THIS PAGE TO A FRIEND

IZUMO1

izumo sperm-egg fusion 1

50 Gene Product Result for
Synonyms: IZUMO
UniProtKB ID: Q8IYV9, Q6Q8P6, Q6Q8P7
Gene ID:
Human(284359) Summary: The sperm-specific protein Izumo, named for a Japanese shrine dedicated to marriage, is essential for sperm-egg plasma membrane binding and fusion (Inoue et al., 2005 [PubMed 15759005]
Mouse(73456) izumo sperm-egg fusion 1
Rat(499152) izumo sperm-egg fusion 1
domestic guinea pig(100728952) izumo sperm-egg fusion 1
naked mole-rat(101718310) izumo sperm-egg fusion 1
sheep(100302705) izumo sperm-egg fusion 1
dog(612013) izumo sperm-egg fusion 1
cow(618057) izumo sperm-egg fusion 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001018013 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001018013 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001018013 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182575 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182575 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182575 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182575 Rosetta Predictions human pricing
NM_001017514 Rosetta Predictions rat pricing
NM_001018013 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182575 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115939 predicted 938
2 SASI_Hs02_00370704 predicted 684
3 SASI_Hs02_00370705 predicted 854
4 SASI_Hs01_00115941 predicted 1106
5 SASI_Hs01_00115942 predicted 918
6 SASI_Hs01_00115943 predicted 630
7 SASI_Hs01_00115944 predicted 1000
8 SASI_Hs01_00115945 predicted 745
9 SASI_Hs02_00370706 predicted 981
10 SASI_Hs01_00115947 predicted 1076
11 SASI_Hs01_00115940 predicted 968
12 SASI_Hs01_00115946 predicted 1055
13 SASI_Hs01_00115948 predicted 1057
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017514 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054064 predicted 484
2 SASI_Rn01_00054065 predicted 734
3 SASI_Rn01_00054066 predicted 350
4 SASI_Rn01_00054067 predicted 867
5 SASI_Rn01_00054068 predicted 498
6 SASI_Rn02_00202354 predicted 718
7 SASI_Rn01_00054070 predicted 345
8 SASI_Rn01_00054071 predicted 870
9 SASI_Rn01_00054072 predicted 842
10 SASI_Rn01_00054073 predicted 661
11 SASI_Rn01_00054069 predicted 919
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018013 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138141 predicted 327
2 SASI_Mm01_00138143 predicted 835
3 SASI_Mm01_00138144 predicted 697
4 SASI_Mm01_00138145 predicted 550
5 SASI_Mm01_00138146 predicted 336
6 SASI_Mm02_00287540 predicted 826
7 SASI_Mm01_00138147 predicted 665
8 SASI_Mm02_00287541 predicted 694
9 SASI_Mm01_00138149 predicted 544
10 SASI_Mm01_00138150 predicted 949
11 SASI_Mm01_00138142 predicted 586
12 SASI_Mm01_00138148 predicted 811
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001018013
IZUMO1 MISSION shRNA Bacterial Glycerol Stock
izumo sperm-egg fusion 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018013.1-578s1c1
Sequence:CCGGGAGCTCTTTATAAAGGAACTACTCGAGTAGTTCCTTTATAAAGAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018013.1-436s1c1
Sequence:CCGGGAACCATGAAGTATCGAGCTTCTCGAGAAGCTCGATACTTCATGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018013.1-1302s1c1
Sequence:CCGGGCGCTAAATTGAAGAATGCAACTCGAGTTGCATTCTTCAATTTAGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018013.1-551s1c1
Sequence:CCGGCGTATTACAGACAGTGACTTACTCGAGTAAGTCACTGTCTGTAATACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018013.1-1052s1c1
Sequence:CCGGCCACCGAACATCATAACCCAACTCGAGTTGGGTTATGATGTTCGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001018013
IZUMO1 MISSION shRNA shRNA Plasmid DNA
izumo sperm-egg fusion 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018013.1-578s1c1
Sequence:CCGGGAGCTCTTTATAAAGGAACTACTCGAGTAGTTCCTTTATAAAGAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018013.1-436s1c1
Sequence:CCGGGAACCATGAAGTATCGAGCTTCTCGAGAAGCTCGATACTTCATGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018013.1-1302s1c1
Sequence:CCGGGCGCTAAATTGAAGAATGCAACTCGAGTTGCATTCTTCAATTTAGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018013.1-551s1c1
Sequence:CCGGCGTATTACAGACAGTGACTTACTCGAGTAAGTCACTGTCTGTAATACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018013.1-1052s1c1
Sequence:CCGGCCACCGAACATCATAACCCAACTCGAGTTGGGTTATGATGTTCGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001018013
IZUMO1 MISSION shRNA Lentiviral Transduction Particles
izumo sperm-egg fusion 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018013.1-578s1c1
Sequence:CCGGGAGCTCTTTATAAAGGAACTACTCGAGTAGTTCCTTTATAAAGAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018013.1-436s1c1
Sequence:CCGGGAACCATGAAGTATCGAGCTTCTCGAGAAGCTCGATACTTCATGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018013.1-1302s1c1
Sequence:CCGGGCGCTAAATTGAAGAATGCAACTCGAGTTGCATTCTTCAATTTAGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018013.1-551s1c1
Sequence:CCGGCGTATTACAGACAGTGACTTACTCGAGTAAGTCACTGTCTGTAATACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018013.1-1052s1c1
Sequence:CCGGCCACCGAACATCATAACCCAACTCGAGTTGGGTTATGATGTTCGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182575
IZUMO1 MISSION shRNA Bacterial Glycerol Stock
izumo sperm-egg fusion 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182575.1-818s1c1
Sequence:CCGGGCTGAAGGATCTGAAACGCATCTCGAGATGCGTTTCAGATCCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182575.1-1466s1c1
Sequence:CCGGCGGCCTTACCTTTGCGATATTCTCGAGAATATCGCAAAGGTAAGGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182575.1-1050s1c1
Sequence:CCGGCGGAATGTGGAAGTTCCTCAACTCGAGTTGAGGAACTTCCACATTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182575.1-956s1c1
Sequence:CCGGCAACAAATGTGGTGTGATGTTCTCGAGAACATCACACCACATTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182575.1-1474s1c1
Sequence:CCGGCCTTTGCGATATTTCGTCGAACTCGAGTTCGACGAAATATCGCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182575.1-1021s1c1
Sequence:CCGGCTTGTCGAAAGTCCTACGATTCTCGAGAATCGTAGGACTTTCGACAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182575.1-1089s1c1
Sequence:CCGGGACTGTGAGTTAAACTGGCATCTCGAGATGCCAGTTTAACTCACAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182575.1-919s1c1
Sequence:CCGGCCTATGTTGCTCGATTCCAAACTCGAGTTTGGAATCGAGCAACATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182575.1-861s1c1
Sequence:CCGGGATCTCTTTGTGAAGGAGCTACTCGAGTAGCTCCTTCACAAAGAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182575.1-1020s1c1
Sequence:CCGGGCTTGTCGAAAGTCCTACGATCTCGAGATCGTAGGACTTTCGACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182575
IZUMO1 MISSION shRNA shRNA Plasmid DNA
izumo sperm-egg fusion 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182575.1-818s1c1
Sequence:CCGGGCTGAAGGATCTGAAACGCATCTCGAGATGCGTTTCAGATCCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182575.1-1466s1c1
Sequence:CCGGCGGCCTTACCTTTGCGATATTCTCGAGAATATCGCAAAGGTAAGGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182575.1-1050s1c1
Sequence:CCGGCGGAATGTGGAAGTTCCTCAACTCGAGTTGAGGAACTTCCACATTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182575.1-956s1c1
Sequence:CCGGCAACAAATGTGGTGTGATGTTCTCGAGAACATCACACCACATTTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182575.1-1474s1c1
Sequence:CCGGCCTTTGCGATATTTCGTCGAACTCGAGTTCGACGAAATATCGCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182575.1-1021s1c1
Sequence:CCGGCTTGTCGAAAGTCCTACGATTCTCGAGAATCGTAGGACTTTCGACAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182575.1-1089s1c1
Sequence:CCGGGACTGTGAGTTAAACTGGCATCTCGAGATGCCAGTTTAACTCACAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182575.1-919s1c1
Sequence:CCGGCCTATGTTGCTCGATTCCAAACTCGAGTTTGGAATCGAGCAACATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182575.1-861s1c1
Sequence:CCGGGATCTCTTTGTGAAGGAGCTACTCGAGTAGCTCCTTCACAAAGAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182575.1-1020s1c1
Sequence:CCGGGCTTGTCGAAAGTCCTACGATCTCGAGATCGTAGGACTTTCGACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182575
IZUMO1 MISSION shRNA Lentiviral Transduction Particles
izumo sperm-egg fusion 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182575.1-818s1c1
Sequence:CCGGGCTGAAGGATCTGAAACGCATCTCGAGATGCGTTTCAGATCCTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182575.1-1466s1c1
Sequence:CCGGCGGCCTTACCTTTGCGATATTCTCGAGAATATCGCAAAGGTAAGGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182575.1-1050s1c1
Sequence:CCGGCGGAATGTGGAAGTTCCTCAACTCGAGTTGAGGAACTTCCACATTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182575.1-956s1c1
Sequence:CCGGCAACAAATGTGGTGTGATGTTCTCGAGAACATCACACCACATTTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182575.1-1474s1c1
Sequence:CCGGCCTTTGCGATATTTCGTCGAACTCGAGTTCGACGAAATATCGCAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182575.1-1021s1c1
Sequence:CCGGCTTGTCGAAAGTCCTACGATTCTCGAGAATCGTAGGACTTTCGACAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182575.1-1089s1c1
Sequence:CCGGGACTGTGAGTTAAACTGGCATCTCGAGATGCCAGTTTAACTCACAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182575.1-919s1c1
Sequence:CCGGCCTATGTTGCTCGATTCCAAACTCGAGTTTGGAATCGAGCAACATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182575.1-861s1c1
Sequence:CCGGGATCTCTTTGTGAAGGAGCTACTCGAGTAGCTCCTTCACAAAGAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182575.1-1020s1c1
Sequence:CCGGGCTTGTCGAAAGTCCTACGATCTCGAGATCGTAGGACTTTCGACAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)