EMAIL THIS PAGE TO A FRIEND

IZUMO2

IZUMO family member 2

85 Gene Product Result for
Synonyms: C19orf41 PLAL6978 PRO21961 SCRL
UniProtKB ID: Q6UXV1, Q5GRG3, Q5GRG4, Q6ZNM5, Q8NHR8
Gene ID:
Mouse(75510) IZUMO family member 2
Rat(499147) IZUMO family member 2
dog(476408) IZUMO family member 2
cow(784290) IZUMO family member 2
domestic cat(101089310) IZUMO family member 2
sheep(101113263) IZUMO family member 2
domestic guinea pig(100720681) IZUMO family member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029317 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029317 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029317 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152358 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152358 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152358 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152358 Rosetta Predictions human pricing
XM_001080631 Rosetta Predictions rat pricing
XM_574442 Rosetta Predictions rat pricing
XM_620490 Rosetta Predictions mouse pricing
XM_901509 Rosetta Predictions mouse pricing
XM_901511 Rosetta Predictions mouse pricing
XM_917226 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152358 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167333 predicted 375
2 SASI_Hs01_00167334 predicted 364
3 SASI_Hs01_00167335 predicted 283
4 SASI_Hs01_00167336 predicted 367
5 SASI_Hs01_00167337 predicted 542
6 SASI_Hs01_00167338 predicted 423
7 SASI_Hs01_00167339 predicted 328
8 SASI_Hs01_00167340 predicted 377
9 SASI_Hs01_00167341 predicted 333
10 SASI_Hs02_00366000 predicted 264
11 SASI_Hs01_00167342 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080631 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00368720 predicted 268
2 SASI_Rn02_00368721 predicted 276
3 SASI_Rn02_00368722 predicted 242
4 SASI_Rn02_00368723 predicted 249
5 SASI_Rn02_00368724 predicted 227
6 SASI_Rn02_00368725 predicted 265
7 SASI_Rn02_00368726 predicted 256
8 SASI_Rn02_00368727 predicted 217
9 SASI_Rn02_00368728 predicted 230
10 SASI_Rn02_00368729 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574442 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00177225 predicted 272
2 SASI_Rn01_00177226 predicted 275
3 SASI_Rn01_00177227 predicted 244
4 SASI_Rn01_00177228 predicted 245
5 SASI_Rn01_00177229 predicted 233
6 SASI_Rn01_00177230 predicted 263
7 SASI_Rn01_00177231 predicted 262
8 SASI_Rn01_00177232 predicted 221
9 SASI_Rn01_00177233 predicted 231
10 SASI_Rn02_00402030 predicted 281
11 SASI_Rn01_00177224 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_620490 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00219665 predicted 226
2 SASI_Mm01_00219666 predicted 354
3 SASI_Mm01_00219667 predicted 385
4 SASI_Mm01_00219668 predicted 295
5 SASI_Mm01_00219669 predicted 355
6 SASI_Mm01_00219673 predicted 360
7 SASI_Mm02_00427629 predicted 271
8 SASI_Mm02_00427630 predicted 224
9 SASI_Mm01_00219674 predicted 258
10 SASI_Mm02_00427631 predicted 286
11 SASI_Mm01_00219670 predicted 361
12 SASI_Mm01_00219671 predicted 371
13 SASI_Mm01_00219672 predicted 283
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901509 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00247096 predicted 456
2 SASI_Mm01_00247097 predicted 466
3 SASI_Mm01_00247098 predicted 470
4 SASI_Mm01_00247099 predicted 551
5 SASI_Mm01_00247100 predicted 537
6 SASI_Mm01_00247101 predicted 614
7 SASI_Mm01_00247102 predicted 561
8 SASI_Mm01_00247103 predicted 526
9 SASI_Mm01_00247104 predicted 395
10 SASI_Mm01_00247105 predicted 525
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901511 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246915 predicted 487
2 SASI_Mm01_00246916 predicted 489
3 SASI_Mm01_00246917 predicted 504
4 SASI_Mm01_00246918 predicted 621
5 SASI_Mm01_00246919 predicted 587
6 SASI_Mm01_00246920 predicted 576
7 SASI_Mm01_00246921 predicted 664
8 SASI_Mm01_00246922 predicted 619
9 SASI_Mm01_00246923 predicted 573
10 SASI_Mm01_00246924 predicted 605
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_917226 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00440957 predicted 340
2 SASI_Mm02_00440958 predicted 225
3 SASI_Mm02_00440959 predicted 349
4 SASI_Mm02_00440960 predicted 383
5 SASI_Mm02_00440961 predicted 302
6 SASI_Mm02_00440962 predicted 350
7 SASI_Mm02_00440963 predicted 366
8 SASI_Mm02_00440964 predicted 269
9 SASI_Mm02_00440965 predicted 224
10 SASI_Mm02_00440966 predicted 262
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029317
IZUMO2 MISSION shRNA Bacterial Glycerol Stock
IZUMO family member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029317.1-225s21c1
Sequence:CCGGGAAAGTGGTCGTGGATCAACTCTCGAGAGTTGATCCACGACCACTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029317.1-356s21c1
Sequence:CCGGAGGAACTAAAGGGAGCATTAACTCGAGTTAATGCTCCCTTTAGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029317.1-267s21c1
Sequence:CCGGCAAGAACCAAGCCCAGTATATCTCGAGATATACTGGGCTTGGTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029317.1-199s21c1
Sequence:CCGGGACTATGCAATGAACGCTTTCCTCGAGGAAAGCGTTCATTGCATAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029317.1-459s21c1
Sequence:CCGGCAAACCAAGGAACATGGTATTCTCGAGAATACCATGTTCCTTGGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029317
IZUMO2 MISSION shRNA shRNA Plasmid DNA
IZUMO family member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029317.1-225s21c1
Sequence:CCGGGAAAGTGGTCGTGGATCAACTCTCGAGAGTTGATCCACGACCACTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029317.1-356s21c1
Sequence:CCGGAGGAACTAAAGGGAGCATTAACTCGAGTTAATGCTCCCTTTAGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029317.1-267s21c1
Sequence:CCGGCAAGAACCAAGCCCAGTATATCTCGAGATATACTGGGCTTGGTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029317.1-199s21c1
Sequence:CCGGGACTATGCAATGAACGCTTTCCTCGAGGAAAGCGTTCATTGCATAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029317.1-459s21c1
Sequence:CCGGCAAACCAAGGAACATGGTATTCTCGAGAATACCATGTTCCTTGGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029317
IZUMO2 MISSION shRNA Lentiviral Transduction Particles
IZUMO family member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029317.1-225s21c1
Sequence:CCGGGAAAGTGGTCGTGGATCAACTCTCGAGAGTTGATCCACGACCACTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029317.1-356s21c1
Sequence:CCGGAGGAACTAAAGGGAGCATTAACTCGAGTTAATGCTCCCTTTAGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029317.1-267s21c1
Sequence:CCGGCAAGAACCAAGCCCAGTATATCTCGAGATATACTGGGCTTGGTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029317.1-199s21c1
Sequence:CCGGGACTATGCAATGAACGCTTTCCTCGAGGAAAGCGTTCATTGCATAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029317.1-459s21c1
Sequence:CCGGCAAACCAAGGAACATGGTATTCTCGAGAATACCATGTTCCTTGGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152358
IZUMO2 MISSION shRNA Bacterial Glycerol Stock
IZUMO family member 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152358.1-372s1c1
Sequence:CCGGCCAAACTTTGCCGCTTGCTAACTCGAGTTAGCAAGCGGCAAAGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152358.1-538s1c1
Sequence:CCGGCATCCTCATTTCTGTGTCTCTCTCGAGAGAGACACAGAAATGAGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152358.1-202s1c1
Sequence:CCGGGACAAATCAACTGGACCTTGTCTCGAGACAAGGTCCAGTTGATTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152358.1-493s1c1
Sequence:CCGGGTACCAGATGGACAGCAAATACTCGAGTATTTGCTGTCCATCTGGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152358.1-424s1c1
Sequence:CCGGGAGGATCACTCCCAAGTGTATCTCGAGATACACTTGGGAGTGATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152358
IZUMO2 MISSION shRNA shRNA Plasmid DNA
IZUMO family member 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152358.1-372s1c1
Sequence:CCGGCCAAACTTTGCCGCTTGCTAACTCGAGTTAGCAAGCGGCAAAGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152358.1-538s1c1
Sequence:CCGGCATCCTCATTTCTGTGTCTCTCTCGAGAGAGACACAGAAATGAGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152358.1-202s1c1
Sequence:CCGGGACAAATCAACTGGACCTTGTCTCGAGACAAGGTCCAGTTGATTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152358.1-493s1c1
Sequence:CCGGGTACCAGATGGACAGCAAATACTCGAGTATTTGCTGTCCATCTGGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152358.1-424s1c1
Sequence:CCGGGAGGATCACTCCCAAGTGTATCTCGAGATACACTTGGGAGTGATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152358
IZUMO2 MISSION shRNA Lentiviral Transduction Particles
IZUMO family member 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152358.1-372s1c1
Sequence:CCGGCCAAACTTTGCCGCTTGCTAACTCGAGTTAGCAAGCGGCAAAGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152358.1-538s1c1
Sequence:CCGGCATCCTCATTTCTGTGTCTCTCTCGAGAGAGACACAGAAATGAGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152358.1-202s1c1
Sequence:CCGGGACAAATCAACTGGACCTTGTCTCGAGACAAGGTCCAGTTGATTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152358.1-493s1c1
Sequence:CCGGGTACCAGATGGACAGCAAATACTCGAGTATTTGCTGTCCATCTGGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152358.1-424s1c1
Sequence:CCGGGAGGATCACTCCCAAGTGTATCTCGAGATACACTTGGGAGTGATCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)