EMAIL THIS PAGE TO A FRIEND

IZUMO4

IZUMO family member 4

66 Gene Product Result for
Synonyms: C19orf36 IMAGE:4215339
UniProtKB ID: Q1ZYL8, A7RA93, A7RA94, Q6UXA2, Q96FT6, Q96L02
Gene ID:
Mouse(71564) IZUMO family member 4
Rat(362832) IZUMO family member 4
dog(612202) IZUMO family member 4
cow(510569) IZUMO family member 4
domestic cat(101100698) IZUMO family member 4
domestic guinea pig(100713045) IZUMO family member 4
naked mole-rat(101714032) IZUMO family member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052878 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052878 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052878 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027829 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027829 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027829 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031735 Rosetta Predictions human pricing
NM_001039846 Rosetta Predictions human pricing
XM_001071667 Rosetta Predictions rat pricing
XM_343160 Rosetta Predictions rat pricing
NM_027829 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031735 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126434 predicted 287
2 SASI_Hs01_00126435 predicted 312
3 SASI_Hs01_00126436 predicted 317
4 SASI_Hs01_00126438 predicted 241
5 SASI_Hs01_00126439 predicted 315
6 SASI_Hs01_00126440 predicted 385
7 SASI_Hs01_00126441 predicted 284
8 SASI_Hs01_00126442 predicted 239
9 SASI_Hs01_00126443 predicted 296
10 SASI_Hs01_00126437 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039846 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107420 predicted 286
2 SASI_Hs01_00107421 predicted 310
3 SASI_Hs01_00107422 predicted 315
4 SASI_Hs01_00107424 predicted 239
5 SASI_Hs01_00107425 predicted 309
6 SASI_Hs01_00107426 predicted 382
7 SASI_Hs01_00107427 predicted 275
8 SASI_Hs01_00107428 predicted 239
9 SASI_Hs01_00107429 predicted 289
10 SASI_Hs01_00107423 predicted 292
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071667 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00335960 predicted 612
2 SASI_Rn02_00335961 predicted 242
3 SASI_Rn02_00335962 predicted 382
4 SASI_Rn02_00335963 predicted 274
5 SASI_Rn02_00335964 predicted 541
6 SASI_Rn02_00335965 predicted 387
7 SASI_Rn02_00335966 predicted 615
8 SASI_Rn02_00335967 predicted 209
9 SASI_Rn02_00335968 predicted 501
10 SASI_Rn02_00335969 predicted 209
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343160 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395393 predicted 613
2 SASI_Rn02_00395394 predicted 574
3 SASI_Rn02_00395395 predicted 545
4 SASI_Rn02_00395396 predicted 527
5 SASI_Rn02_00395397 predicted 427
6 SASI_Rn02_00395398 predicted 543
7 SASI_Rn02_00395399 predicted 611
8 SASI_Rn02_00395400 predicted 521
9 SASI_Rn02_00395401 predicted 448
10 SASI_Rn02_00395402 predicted 435
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027829 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060747 predicted 391
2 SASI_Mm01_00060748 predicted 333
3 SASI_Mm01_00060750 predicted 270
4 SASI_Mm01_00060751 predicted 290
5 SASI_Mm01_00060752 predicted 537
6 SASI_Mm01_00060753 predicted 415
7 SASI_Mm01_00060754 predicted 491
8 SASI_Mm01_00060755 predicted 267
9 SASI_Mm02_00332780 predicted 269
10 SASI_Mm02_00332781 predicted 224
11 SASI_Mm01_00060749 predicted 260
12 SASI_Mm01_00060756 predicted 688
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052878
IZUMO4 MISSION shRNA Bacterial Glycerol Stock
IZUMO family member 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052878.1-140s1c1
Sequence:CCGGCCACAGCAACTTCTCCAAGAACTCGAGTTCTTGGAGAAGTTGCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052878.1-386s1c1
Sequence:CCGGCAACGAGCTGCGAAACATCTTCTCGAGAAGATGTTTCGCAGCTCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052878.1-650s1c1
Sequence:CCGGCATGGACACACATACATGAAACTCGAGTTTCATGTATGTGTGTCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052878.1-510s1c1
Sequence:CCGGCCTGAAGGATCAATGCCATCACTCGAGTGATGGCATTGATCCTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052878.1-176s1c1
Sequence:CCGGCCACCATGTGAACTTCAAGTCCTCGAGGACTTGAAGTTCACATGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052878.1-760s1c1
Sequence:CCGGGCTTTGGCTATAACTGCGAGTCTCGAGACTCGCAGTTATAGCCAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136882    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052878.1-649s1c1
Sequence:CCGGCCATGGACACACATACATGAACTCGAGTTCATGTATGTGTGTCCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052878
IZUMO4 MISSION shRNA shRNA Plasmid DNA
IZUMO family member 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052878.1-140s1c1
Sequence:CCGGCCACAGCAACTTCTCCAAGAACTCGAGTTCTTGGAGAAGTTGCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052878.1-386s1c1
Sequence:CCGGCAACGAGCTGCGAAACATCTTCTCGAGAAGATGTTTCGCAGCTCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052878.1-650s1c1
Sequence:CCGGCATGGACACACATACATGAAACTCGAGTTTCATGTATGTGTGTCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052878.1-510s1c1
Sequence:CCGGCCTGAAGGATCAATGCCATCACTCGAGTGATGGCATTGATCCTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052878.1-176s1c1
Sequence:CCGGCCACCATGTGAACTTCAAGTCCTCGAGGACTTGAAGTTCACATGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052878.1-760s1c1
Sequence:CCGGGCTTTGGCTATAACTGCGAGTCTCGAGACTCGCAGTTATAGCCAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136882    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052878.1-649s1c1
Sequence:CCGGCCATGGACACACATACATGAACTCGAGTTCATGTATGTGTGTCCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052878
IZUMO4 MISSION shRNA Lentiviral Transduction Particles
IZUMO family member 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052878.1-140s1c1
Sequence:CCGGCCACAGCAACTTCTCCAAGAACTCGAGTTCTTGGAGAAGTTGCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052878.1-386s1c1
Sequence:CCGGCAACGAGCTGCGAAACATCTTCTCGAGAAGATGTTTCGCAGCTCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052878.1-650s1c1
Sequence:CCGGCATGGACACACATACATGAAACTCGAGTTTCATGTATGTGTGTCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052878.1-510s1c1
Sequence:CCGGCCTGAAGGATCAATGCCATCACTCGAGTGATGGCATTGATCCTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052878.1-176s1c1
Sequence:CCGGCCACCATGTGAACTTCAAGTCCTCGAGGACTTGAAGTTCACATGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052878.1-760s1c1
Sequence:CCGGGCTTTGGCTATAACTGCGAGTCTCGAGACTCGCAGTTATAGCCAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136882    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052878.1-649s1c1
Sequence:CCGGCCATGGACACACATACATGAACTCGAGTTCATGTATGTGTGTCCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027829
IZUMO4 MISSION shRNA Bacterial Glycerol Stock
IZUMO family member 4
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027829.3-759s21c1
Sequence:CCGGTTGCCTCTGGAGAAGCTAGCTCTCGAGAGCTAGCTTCTCCAGAGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027829.3-397s21c1
Sequence:CCGGTCATCCAGAACGCCATCATAGCTCGAGCTATGATGGCGTTCTGGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027829.3-336s21c1
Sequence:CCGGATGTACTTCCCAGGGTATTTCCTCGAGGAAATACCCTGGGAAGTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027829.3-265s21c1
Sequence:CCGGTCACCCGGAAGAAGCTATATCCTCGAGGATATAGCTTCTTCCGGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027829.1-383s1c1
Sequence:CCGGGCTTTGGCTACTACTGCAAGTCTCGAGACTTGCAGTAGTAGCCAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027829.3-553s21c1
Sequence:CCGGAGGGCCTTCTGAAATACATAACTCGAGTTATGTATTTCAGAAGGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027829
IZUMO4 MISSION shRNA shRNA Plasmid DNA
IZUMO family member 4
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027829.3-759s21c1
Sequence:CCGGTTGCCTCTGGAGAAGCTAGCTCTCGAGAGCTAGCTTCTCCAGAGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027829.3-397s21c1
Sequence:CCGGTCATCCAGAACGCCATCATAGCTCGAGCTATGATGGCGTTCTGGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027829.3-336s21c1
Sequence:CCGGATGTACTTCCCAGGGTATTTCCTCGAGGAAATACCCTGGGAAGTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027829.3-265s21c1
Sequence:CCGGTCACCCGGAAGAAGCTATATCCTCGAGGATATAGCTTCTTCCGGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027829.1-383s1c1
Sequence:CCGGGCTTTGGCTACTACTGCAAGTCTCGAGACTTGCAGTAGTAGCCAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027829.3-553s21c1
Sequence:CCGGAGGGCCTTCTGAAATACATAACTCGAGTTATGTATTTCAGAAGGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027829
IZUMO4 MISSION shRNA Lentiviral Transduction Particles
IZUMO family member 4
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027829.3-759s21c1
Sequence:CCGGTTGCCTCTGGAGAAGCTAGCTCTCGAGAGCTAGCTTCTCCAGAGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027829.3-397s21c1
Sequence:CCGGTCATCCAGAACGCCATCATAGCTCGAGCTATGATGGCGTTCTGGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027829.3-336s21c1
Sequence:CCGGATGTACTTCCCAGGGTATTTCCTCGAGGAAATACCCTGGGAAGTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027829.3-265s21c1
Sequence:CCGGTCACCCGGAAGAAGCTATATCCTCGAGGATATAGCTTCTTCCGGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027829.1-383s1c1
Sequence:CCGGGCTTTGGCTACTACTGCAAGTCTCGAGACTTGCAGTAGTAGCCAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027829.3-553s21c1
Sequence:CCGGAGGGCCTTCTGAAATACATAACTCGAGTTATGTATTTCAGAAGGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)