EMAIL THIS PAGE TO A FRIEND

JAG1

jagged 1

152 Gene Product Result for
Synonyms: AGS AHD AWS CD339 HJ1 JAGL1
UniProtKB ID: P78504, A0AV43, O14902, O15122, Q15816
Gene ID:
Human(182) Summary: The jagged 1 protein encoded by JAG1 is the human homolog of the Drosophilia jagged protein. Human jagged 1 is the ligand for the receptor notch 1, the latter a human homolog of the Drosophilia jagged receptor notch. Mutations that alter the jagged 1 protein cause Alagille syndrome. Jagged 1 signalling through notch 1 has also been shown to play a role in hematopoiesis. [provided by RefSeq, Jul 2008]
Mouse(16449) jagged 1
Rat(29146) jagged 1
chicken(396043) jagged 1
dog(485769) jagged 1
Horse(100064289) jagged 1
cow(783681) jagged 1
sheep(780486) jagged 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
N9286 Notch-1/Fc Chimera from rat recombinant, expressed in NSO cells, ≥90% (SDS-PAGE), lyophilized powder, from rat human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013822 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013822 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013822 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000214 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000214 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000214 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000214 Rosetta Predictions human pricing
NM_019147 Rosetta Predictions rat pricing
NM_013822 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000214 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100441 predicted 1755
2 SASI_Hs01_00100442 predicted 2728
3 SASI_Hs01_00100443 predicted 2087
4 SASI_Hs02_00302102 predicted 2973
5 SASI_Hs01_00100444 predicted 2288
6 SASI_Hs01_00100445 predicted 947
7 SASI_Hs01_00100447 predicted 3651
8 SASI_Hs01_00100448 predicted 1231
9 SASI_Hs01_00100449 predicted 4152
10 SASI_Hs01_00100450 predicted 3677
11 SASI_Hs01_00100446 predicted 3938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019147 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096856 predicted 4029
2 SASI_Rn01_00096859 predicted 813
3 SASI_Rn01_00096860 predicted 1664
4 SASI_Rn01_00096861 predicted 801
5 SASI_Rn01_00096862 predicted 1832
6 SASI_Rn01_00096863 predicted 2552
7 SASI_Rn01_00096864 predicted 3258
8 SASI_Rn01_00096865 predicted 739
9 SASI_Rn02_00261917 predicted 2587
10 SASI_Rn02_00261918 predicted 1003
11 SASI_Rn01_00096857 predicted 1517
12 SASI_Rn01_00096858 predicted 3257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013822 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189966 predicted 500
2 SASI_Mm01_00189967 predicted 955
3 SASI_Mm01_00189968 predicted 791
4 SASI_Mm01_00189969 predicted 3801
5 SASI_Mm01_00189971 predicted 2988
6 SASI_Mm01_00189972 predicted 308
7 SASI_Mm01_00189973 predicted 425
8 SASI_Mm02_00322793 predicted 2944
9 SASI_Mm01_00189974 predicted 490
10 SASI_Mm01_00189975 predicted 3593
11 SASI_Mm01_00189970 predicted 2983
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013822
VALIDATED
JAG1 MISSION shRNA Bacterial Glycerol Stock
jagged 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000279331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013822.4-1199s21c1
Sequence:CCGGCGATGACTGTTCTCCAAATAACTCGAGTTATTTGGAGAACAGTCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013822.4-3650s21c1
Sequence:CCGGACACCCGAACTGGACAAATAACTCGAGTTATTTGTCCAGTTCGGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279297    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013822.4-4025s21c1
Sequence:CCGGACATCTGCCAGCGGTCCTAATCTCGAGATTAGGACCGCTGGCAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013822.4-2200s21c1
Sequence:CCGGGTGACGAAGCCACGTGTAATACTCGAGTATTACACGTGGCTTCGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013822.4-2237s21c1
Sequence:CCGGTGATGAAGTGGACACGTTTAACTCGAGTTAAACGTGTCCACTTCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013822.2-2937s1c1
Sequence:CCGGCCAGGATAACTGTGCAAACATCTCGAGATGTTTGCACAGTTATCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013822.2-3296s1c1
Sequence:CCGGGCTCTGTCTTAACAGTGGCTTCTCGAGAAGCCACTGTTAAGACAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013822.2-1468s1c1
Sequence:CCGGCGGGATTTGGTTAATGGTTATCTCGAGATAACCATTAACCAAATCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013822.2-3711s1c1
Sequence:CCGGCCGGATGGAATACATCGTATACTCGAGTATACGATGTATTCCATCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013822.2-1200s1c1
Sequence:CCGGCGATGACTGTTCTCCAAATAACTCGAGTTATTTGGAGAACAGTCATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013822
VALIDATED
JAG1 MISSION shRNA shRNA Plasmid DNA
jagged 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000279331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013822.4-1199s21c1
Sequence:CCGGCGATGACTGTTCTCCAAATAACTCGAGTTATTTGGAGAACAGTCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013822.4-3650s21c1
Sequence:CCGGACACCCGAACTGGACAAATAACTCGAGTTATTTGTCCAGTTCGGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279297    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013822.4-4025s21c1
Sequence:CCGGACATCTGCCAGCGGTCCTAATCTCGAGATTAGGACCGCTGGCAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013822.4-2200s21c1
Sequence:CCGGGTGACGAAGCCACGTGTAATACTCGAGTATTACACGTGGCTTCGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013822.4-2237s21c1
Sequence:CCGGTGATGAAGTGGACACGTTTAACTCGAGTTAAACGTGTCCACTTCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013822.2-2937s1c1
Sequence:CCGGCCAGGATAACTGTGCAAACATCTCGAGATGTTTGCACAGTTATCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013822.2-3296s1c1
Sequence:CCGGGCTCTGTCTTAACAGTGGCTTCTCGAGAAGCCACTGTTAAGACAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013822.2-1468s1c1
Sequence:CCGGCGGGATTTGGTTAATGGTTATCTCGAGATAACCATTAACCAAATCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013822.2-3711s1c1
Sequence:CCGGCCGGATGGAATACATCGTATACTCGAGTATACGATGTATTCCATCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013822.2-1200s1c1
Sequence:CCGGCGATGACTGTTCTCCAAATAACTCGAGTTATTTGGAGAACAGTCATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013822
VALIDATED
JAG1 MISSION shRNA Lentiviral Transduction Particles
jagged 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000279331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013822.4-1199s21c1
Sequence:CCGGCGATGACTGTTCTCCAAATAACTCGAGTTATTTGGAGAACAGTCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013822.4-3650s21c1
Sequence:CCGGACACCCGAACTGGACAAATAACTCGAGTTATTTGTCCAGTTCGGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279297    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013822.4-4025s21c1
Sequence:CCGGACATCTGCCAGCGGTCCTAATCTCGAGATTAGGACCGCTGGCAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013822.4-2200s21c1
Sequence:CCGGGTGACGAAGCCACGTGTAATACTCGAGTATTACACGTGGCTTCGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013822.4-2237s21c1
Sequence:CCGGTGATGAAGTGGACACGTTTAACTCGAGTTAAACGTGTCCACTTCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013822.2-2937s1c1
Sequence:CCGGCCAGGATAACTGTGCAAACATCTCGAGATGTTTGCACAGTTATCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013822.2-3296s1c1
Sequence:CCGGGCTCTGTCTTAACAGTGGCTTCTCGAGAAGCCACTGTTAAGACAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013822.2-1468s1c1
Sequence:CCGGCGGGATTTGGTTAATGGTTATCTCGAGATAACCATTAACCAAATCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013822.2-3711s1c1
Sequence:CCGGCCGGATGGAATACATCGTATACTCGAGTATACGATGTATTCCATCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013822.2-1200s1c1
Sequence:CCGGCGATGACTGTTCTCCAAATAACTCGAGTTATTTGGAGAACAGTCATCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000214
VALIDATED
JAG1 MISSION shRNA Bacterial Glycerol Stock
jagged 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000214.2-2081s21c1
Sequence:CCGGGTCAGCTGGACATCGATTATTCTCGAGAATAATCGATGTCCAGCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000214.2-5053s21c1
Sequence:CCGGACCTTCTATAGCATCACTTAACTCGAGTTAAGTGATGCTATAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000214.2-3357s21c1
Sequence:CCGGGTGCACCTCTGACTCCTATTACTCGAGTAATAGGAGTCAGAGGTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_000214.2-1686s21c1
Sequence:CCGGGGACCTGGTTAACGGATTTAACTCGAGTTAAATCCGTTAACCAGGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000214.1-3340s1c1
Sequence:CCGGCGGAGCACATTTGCAGTGAATCTCGAGATTCACTGCAAATGTGCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000214.1-1092s1c1
Sequence:CCGGCCCGAATGTAACAGAGCTATTCTCGAGAATAGCTCTGTTACATTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_000214.1-847s1c1
Sequence:CCGGCCGTTCAACCTGACAGTATTACTCGAGTAATACTGTCAGGTTGAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000214.1-3275s1c1
Sequence:CCGGCCAGGATAACTGTGCGAACATCTCGAGATGTTCGCACAGTTATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_000214.1-4049s1c1
Sequence:CCGGCCGAATGGAGTACATCGTATACTCGAGTATACGATGTACTCCATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_000214.2-2501s21c1
Sequence:CCGGCCTACTGTGAAACCAATATTACTCGAGTAATATTGGTTTCACAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000214
VALIDATED
JAG1 MISSION shRNA shRNA Plasmid DNA
jagged 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000214.2-2081s21c1
Sequence:CCGGGTCAGCTGGACATCGATTATTCTCGAGAATAATCGATGTCCAGCTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000214.2-5053s21c1
Sequence:CCGGACCTTCTATAGCATCACTTAACTCGAGTTAAGTGATGCTATAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000214.2-3357s21c1
Sequence:CCGGGTGCACCTCTGACTCCTATTACTCGAGTAATAGGAGTCAGAGGTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_000214.2-1686s21c1
Sequence:CCGGGGACCTGGTTAACGGATTTAACTCGAGTTAAATCCGTTAACCAGGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000214.1-3340s1c1
Sequence:CCGGCGGAGCACATTTGCAGTGAATCTCGAGATTCACTGCAAATGTGCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000214.1-1092s1c1
Sequence:CCGGCCCGAATGTAACAGAGCTATTCTCGAGAATAGCTCTGTTACATTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_000214.1-847s1c1
Sequence:CCGGCCGTTCAACCTGACAGTATTACTCGAGTAATACTGTCAGGTTGAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000214.1-3275s1c1
Sequence:CCGGCCAGGATAACTGTGCGAACATCTCGAGATGTTCGCACAGTTATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_000214.1-4049s1c1
Sequence:CCGGCCGAATGGAGTACATCGTATACTCGAGTATACGATGTACTCCATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_000214.2-2501s21c1
Sequence:CCGGCCTACTGTGAAACCAATATTACTCGAGTAATATTGGTTTCACAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000214
VALIDATED
JAG1 MISSION shRNA Lentiviral Transduction Particles
jagged 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000214.2-2081s21c1
Sequence:CCGGGTCAGCTGGACATCGATTATTCTCGAGAATAATCGATGTCCAGCTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000214.2-5053s21c1
Sequence:CCGGACCTTCTATAGCATCACTTAACTCGAGTTAAGTGATGCTATAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000214.2-3357s21c1
Sequence:CCGGGTGCACCTCTGACTCCTATTACTCGAGTAATAGGAGTCAGAGGTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_000214.2-1686s21c1
Sequence:CCGGGGACCTGGTTAACGGATTTAACTCGAGTTAAATCCGTTAACCAGGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000214.1-3340s1c1
Sequence:CCGGCGGAGCACATTTGCAGTGAATCTCGAGATTCACTGCAAATGTGCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000214.1-1092s1c1
Sequence:CCGGCCCGAATGTAACAGAGCTATTCTCGAGAATAGCTCTGTTACATTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_000214.1-847s1c1
Sequence:CCGGCCGTTCAACCTGACAGTATTACTCGAGTAATACTGTCAGGTTGAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000214.1-3275s1c1
Sequence:CCGGCCAGGATAACTGTGCGAACATCTCGAGATGTTCGCACAGTTATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_000214.1-4049s1c1
Sequence:CCGGCCGAATGGAGTACATCGTATACTCGAGTATACGATGTACTCCATTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_000214.2-2501s21c1
Sequence:CCGGCCTACTGTGAAACCAATATTACTCGAGTAATATTGGTTTCACAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)