EMAIL THIS PAGE TO A FRIEND

JAK1

Janus kinase 1

116 Gene Product Result for
Synonyms: JAK1A JAK1B JTK3
UniProtKB ID: P23458, Q59GQ2, Q9UD26
Gene ID:
Human(3716) Summary: Janus kinase 1 (JAK1), is a member of a new class of protein-tyrosine kinases (PTK) characterized by the presence of a second phosphotransferase-related domain immediately N-terminal to the PTK domain. The second phosphotransferase domain bears all the hallmarks of a protein kinase, although its structure differs significantly from that of the PTK and threonine/serine kinase family members. JAK1 is a large, widely expressed membrane-associated phosphoprotein. JAK1 is involved in the interferon-alpha/beta and -gamma signal transduction pathways. The reciprocal interdependence between JAK1 and TYK2 activities in the interferon-alpha pathway, and between JAK1 and JAK2 in the interferon-gamma pathway, may reflect a requirement for these kinases in the correct assembly of interferon receptor complexes. These kinases couple cytokine ligand binding to tyrosine phosphorylation of various known signaling proteins and of a unique family of transcription factors termed the signal transducers and activators of transcription, or STATs. [provided by RefSeq, Jul 2008]
Mouse(16451) Janus kinase 1
Rat(84598) Janus kinase 1
Zebrafish(30280) Janus kinase 1
domestic cat(101084377) Janus kinase 1
Horse(100054008) Janus kinase 1
cow(537201) Janus kinase 1
dog(442952) Janus kinase 1
chicken(395681) Janus kinase 1
naked mole-rat(101710283) Janus kinase 1
sheep(101110716) Janus kinase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0970 Phosphotyrosine JAK1 / Tyrosine-protein Kinase JAK1 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146145 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146145 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146145 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002227 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002227 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002227 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002227 siRNAs that have been validated in the lab human pricing
NM_053466 Rosetta Predictions rat pricing
NM_146145 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002227 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174612 validated 1589
1 SASI_Hs01_00174613 validated 943
1 SASI_Hs01_00174614 validated 3090
2 SASI_Hs01_00174615 predicted 3634
3 SASI_Hs01_00174616 predicted 1537
4 SASI_Hs01_00174617 predicted 3731
5 SASI_Hs01_00174618 predicted 2491
6 SASI_Hs01_00174619 predicted 3757
7 SASI_Hs01_00174620 predicted 3237
8 SASI_Hs01_00174621 predicted 3115
9 SASI_Hs02_00333460 predicted 2520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053466 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266050 predicted 2653
2 SASI_Rn02_00266051 predicted 2807
3 SASI_Rn02_00266052 predicted 1851
4 SASI_Rn02_00266053 predicted 1418
5 SASI_Rn02_00266054 predicted 3207
6 SASI_Rn02_00266055 predicted 2780
7 SASI_Rn02_00266056 predicted 3117
8 SASI_Rn02_00266057 predicted 494
9 SASI_Rn02_00266058 predicted 1786
10 SASI_Rn02_00266059 predicted 1548
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146145 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137469 predicted 2822
2 SASI_Mm02_00341833 predicted 2987
3 SASI_Mm01_00137470 predicted 953
4 SASI_Mm01_00137471 predicted 3383
5 SASI_Mm01_00137472 predicted 1571
6 SASI_Mm01_00137473 predicted 2957
7 SASI_Mm01_00137474 predicted 3367
8 SASI_Mm01_00137475 predicted 664
9 SASI_Mm01_00137477 predicted 529
10 SASI_Mm01_00137478 predicted 3298
11 SASI_Mm01_00137476 predicted 3492
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146145
VALIDATED
JAK1 MISSION shRNA Bacterial Glycerol Stock
Janus kinase 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146145.2-3462s21c1
Sequence:CCGGCGGAATGTTTAATCCAGTGTACTCGAGTACACTGGATTAAACATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146145.2-1639s21c1
Sequence:CCGGCGGTCCAATCTGCACAGAATACTCGAGTATTCTGTGCAGATTGGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146145.2-1018s21c1
Sequence:CCGGTCTTACCAGGATGCGAATAAACTCGAGTTTATTCGCATCCTGGTAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146145.2-2414s21c1
Sequence:CCGGGCCCTGAGTTACTTGGAAGATCTCGAGATCTTCCAAGTAACTCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146145.1-1600s1c1
Sequence:CCGGGCACAGAATATGCCATCAATACTCGAGTATTGATGGCATATTCTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146145.1-2364s1c1
Sequence:CCGGGCCCTGAGTTACTTGGAAGATCTCGAGATCTTCCAAGTAACTCAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146145.1-3412s1c1
Sequence:CCGGCGGAATGTTTAATCCAGTGTACTCGAGTACACTGGATTAAACATTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146145.1-1589s1c1
Sequence:CCGGCGGTCCAATCTGCACAGAATACTCGAGTATTCTGTGCAGATTGGACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146145
VALIDATED
JAK1 MISSION shRNA shRNA Plasmid DNA
Janus kinase 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146145.2-3462s21c1
Sequence:CCGGCGGAATGTTTAATCCAGTGTACTCGAGTACACTGGATTAAACATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146145.2-1639s21c1
Sequence:CCGGCGGTCCAATCTGCACAGAATACTCGAGTATTCTGTGCAGATTGGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146145.2-1018s21c1
Sequence:CCGGTCTTACCAGGATGCGAATAAACTCGAGTTTATTCGCATCCTGGTAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146145.2-2414s21c1
Sequence:CCGGGCCCTGAGTTACTTGGAAGATCTCGAGATCTTCCAAGTAACTCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146145.1-1600s1c1
Sequence:CCGGGCACAGAATATGCCATCAATACTCGAGTATTGATGGCATATTCTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146145.1-2364s1c1
Sequence:CCGGGCCCTGAGTTACTTGGAAGATCTCGAGATCTTCCAAGTAACTCAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146145.1-3412s1c1
Sequence:CCGGCGGAATGTTTAATCCAGTGTACTCGAGTACACTGGATTAAACATTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146145.1-1589s1c1
Sequence:CCGGCGGTCCAATCTGCACAGAATACTCGAGTATTCTGTGCAGATTGGACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146145
VALIDATED
JAK1 MISSION shRNA Lentiviral Transduction Particles
Janus kinase 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146145.2-3462s21c1
Sequence:CCGGCGGAATGTTTAATCCAGTGTACTCGAGTACACTGGATTAAACATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146145.2-1639s21c1
Sequence:CCGGCGGTCCAATCTGCACAGAATACTCGAGTATTCTGTGCAGATTGGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146145.2-1018s21c1
Sequence:CCGGTCTTACCAGGATGCGAATAAACTCGAGTTTATTCGCATCCTGGTAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146145.2-2414s21c1
Sequence:CCGGGCCCTGAGTTACTTGGAAGATCTCGAGATCTTCCAAGTAACTCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146145.1-1600s1c1
Sequence:CCGGGCACAGAATATGCCATCAATACTCGAGTATTGATGGCATATTCTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146145.1-2364s1c1
Sequence:CCGGGCCCTGAGTTACTTGGAAGATCTCGAGATCTTCCAAGTAACTCAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146145.1-3412s1c1
Sequence:CCGGCGGAATGTTTAATCCAGTGTACTCGAGTACACTGGATTAAACATTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146145.1-1589s1c1
Sequence:CCGGCGGTCCAATCTGCACAGAATACTCGAGTATTCTGTGCAGATTGGACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002227
VALIDATED
JAK1 MISSION shRNA Bacterial Glycerol Stock
Janus kinase 1
Human
25 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002227.2-3546s21c1
Sequence:CCGGGACAGTCACAAGACTTGTGAACTCGAGTTCACAAGTCTTGTGACTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002227.2-1176s21c1
Sequence:CCGGCGTTCTCTACTACGAAGTGATCTCGAGATCACTTCGTAGTAGAGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002227.2-1108s21c1
Sequence:CCGGGAGACTTCCATGTTACTGATTCTCGAGAATCAGTAACATGGAAGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002227.2-2353s21c1
Sequence:CCGGCTGAGCTACTTGGAGGATAAACTCGAGTTTATCCTCCAAGTAGCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002227.2-3334s1c1
Sequence:CCGGGAAACCGATAAGGAGTATTACCTCGAGGTAATACTCCTTATCGGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002227.2-3676s1c1
Sequence:CCGGCAGAACCTTATTGAAGGATTTCTCGAGAAATCCTTCAATAAGGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195042    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002227.2-3738s1c1
Sequence:CCGGCCACAGATTATCAAGTCCTTCCTCGAGGAAGGACTTGATAATCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002227.2-3225s1c1
Sequence:CCGGCTATTTGGGTTCTCGGCAATACTCGAGTATTGCCGAGAACCCAAATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002227.1-966s1c1
Sequence:CCGGCGTTCTCTACTACGAAGTGATCTCGAGATCACTTCGTAGTAGAGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002227.1-387s1c1
Sequence:CCGGGCATGGAACCAACGACAATGACTCGAGTCATTGTCGTTGGTTCCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002227.1-572s1c1
Sequence:CCGGCCGAGCAGGATGGACATGATACTCGAGTATCATGTCCATCCTGCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002227.1-2927s1c1
Sequence:CCGGGCCTTAAGGAATATCTTCCAACTCGAGTTGGAAGATATTCCTTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A-431
TRC Version: 1 Clone ID:NM_002227.1-3102s1c1
Sequence:CCGGCTTCGGTTTAACCAAAGCAATCTCGAGATTGCTTTGGTTAAACCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002227.1-1148s1c1
Sequence:CCGGCTGAAATCACTCACATTGTAACTCGAGTTACAATGTGAGTGATTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002227.1-1384s1c1
Sequence:CCGGGCCATCAATAAATTGCGGCAACTCGAGTTGCCGCAATTTATTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A-431
TRC Version: 1 Clone ID:NM_002227.1-1327s1c1
Sequence:CCGGCCGTTGATCGTCCACAACATACTCGAGTATGTTGTGGACGATCAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002227.1-2172s1c1
Sequence:CCGGCCATGGAAATGTGTGTACTAACTCGAGTTAGTACACACATTTCCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002227.1-1814s1c1
Sequence:CCGGGCACGAGAACACACATCTATTCTCGAGAATAGATGTGTGTTCTCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002227.1-693s1c1
Sequence:CCGGGCGATATATTCCAGAAACATTCTCGAGAATGTTTCTGGAATATATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A-431
TRC Version: 1 Clone ID:NM_002227.1-2817s1c1
Sequence:CCGGCGAGATCTTAAGGAACCTCTACTCGAGTAGAGGTTCCTTAAGATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002227.x-2869s1c1
Sequence:CCGGTGCACAGAAGACGGAGGAAATCTCGAGATTTCCTCCGTCTTCTGTGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002227.x-849s1c1
Sequence:CCGGCTTGGCTACCTTGGAAACTTTCTCGAGAAAGTTTCCAAGGTAGCCAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_002227.x-239s1c1
Sequence:CCGGCATGCCGTATCTCTCCTCTTTCTCGAGAAAGAGGAGAGATACGGCATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002227.x-2143s1c1
Sequence:CCGGCTGAGCTACTTGGAGGATAAACTCGAGTTTATCCTCCAAGTAGCTCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002227.x-898s1c1
Sequence:CCGGGAGACTTCCATGTTACTGATTCTCGAGAATCAGTAACATGGAAGTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002227
VALIDATED
JAK1 MISSION shRNA shRNA Plasmid DNA
Janus kinase 1
Human
25 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002227.2-3546s21c1
Sequence:CCGGGACAGTCACAAGACTTGTGAACTCGAGTTCACAAGTCTTGTGACTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002227.2-1176s21c1
Sequence:CCGGCGTTCTCTACTACGAAGTGATCTCGAGATCACTTCGTAGTAGAGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002227.2-1108s21c1
Sequence:CCGGGAGACTTCCATGTTACTGATTCTCGAGAATCAGTAACATGGAAGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002227.2-2353s21c1
Sequence:CCGGCTGAGCTACTTGGAGGATAAACTCGAGTTTATCCTCCAAGTAGCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002227.2-3334s1c1
Sequence:CCGGGAAACCGATAAGGAGTATTACCTCGAGGTAATACTCCTTATCGGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002227.2-3676s1c1
Sequence:CCGGCAGAACCTTATTGAAGGATTTCTCGAGAAATCCTTCAATAAGGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195042    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002227.2-3738s1c1
Sequence:CCGGCCACAGATTATCAAGTCCTTCCTCGAGGAAGGACTTGATAATCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002227.2-3225s1c1
Sequence:CCGGCTATTTGGGTTCTCGGCAATACTCGAGTATTGCCGAGAACCCAAATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002227.1-966s1c1
Sequence:CCGGCGTTCTCTACTACGAAGTGATCTCGAGATCACTTCGTAGTAGAGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002227.1-387s1c1
Sequence:CCGGGCATGGAACCAACGACAATGACTCGAGTCATTGTCGTTGGTTCCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002227.1-572s1c1
Sequence:CCGGCCGAGCAGGATGGACATGATACTCGAGTATCATGTCCATCCTGCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002227.1-2927s1c1
Sequence:CCGGGCCTTAAGGAATATCTTCCAACTCGAGTTGGAAGATATTCCTTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A-431
TRC Version: 1 Clone ID:NM_002227.1-3102s1c1
Sequence:CCGGCTTCGGTTTAACCAAAGCAATCTCGAGATTGCTTTGGTTAAACCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002227.1-1148s1c1
Sequence:CCGGCTGAAATCACTCACATTGTAACTCGAGTTACAATGTGAGTGATTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002227.1-1384s1c1
Sequence:CCGGGCCATCAATAAATTGCGGCAACTCGAGTTGCCGCAATTTATTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A-431
TRC Version: 1 Clone ID:NM_002227.1-1327s1c1
Sequence:CCGGCCGTTGATCGTCCACAACATACTCGAGTATGTTGTGGACGATCAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002227.1-2172s1c1
Sequence:CCGGCCATGGAAATGTGTGTACTAACTCGAGTTAGTACACACATTTCCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002227.1-1814s1c1
Sequence:CCGGGCACGAGAACACACATCTATTCTCGAGAATAGATGTGTGTTCTCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002227.1-693s1c1
Sequence:CCGGGCGATATATTCCAGAAACATTCTCGAGAATGTTTCTGGAATATATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A-431
TRC Version: 1 Clone ID:NM_002227.1-2817s1c1
Sequence:CCGGCGAGATCTTAAGGAACCTCTACTCGAGTAGAGGTTCCTTAAGATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002227.x-2869s1c1
Sequence:CCGGTGCACAGAAGACGGAGGAAATCTCGAGATTTCCTCCGTCTTCTGTGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002227.x-849s1c1
Sequence:CCGGCTTGGCTACCTTGGAAACTTTCTCGAGAAAGTTTCCAAGGTAGCCAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_002227.x-239s1c1
Sequence:CCGGCATGCCGTATCTCTCCTCTTTCTCGAGAAAGAGGAGAGATACGGCATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002227.x-2143s1c1
Sequence:CCGGCTGAGCTACTTGGAGGATAAACTCGAGTTTATCCTCCAAGTAGCTCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002227.x-898s1c1
Sequence:CCGGGAGACTTCCATGTTACTGATTCTCGAGAATCAGTAACATGGAAGTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002227
VALIDATED
JAK1 MISSION shRNA Lentiviral Transduction Particles
Janus kinase 1
Human
25 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002227.2-3546s21c1
Sequence:CCGGGACAGTCACAAGACTTGTGAACTCGAGTTCACAAGTCTTGTGACTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002227.2-1176s21c1
Sequence:CCGGCGTTCTCTACTACGAAGTGATCTCGAGATCACTTCGTAGTAGAGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002227.2-1108s21c1
Sequence:CCGGGAGACTTCCATGTTACTGATTCTCGAGAATCAGTAACATGGAAGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002227.2-2353s21c1
Sequence:CCGGCTGAGCTACTTGGAGGATAAACTCGAGTTTATCCTCCAAGTAGCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002227.2-3334s1c1
Sequence:CCGGGAAACCGATAAGGAGTATTACCTCGAGGTAATACTCCTTATCGGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002227.2-3676s1c1
Sequence:CCGGCAGAACCTTATTGAAGGATTTCTCGAGAAATCCTTCAATAAGGTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195042    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002227.2-3738s1c1
Sequence:CCGGCCACAGATTATCAAGTCCTTCCTCGAGGAAGGACTTGATAATCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002227.2-3225s1c1
Sequence:CCGGCTATTTGGGTTCTCGGCAATACTCGAGTATTGCCGAGAACCCAAATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002227.1-966s1c1
Sequence:CCGGCGTTCTCTACTACGAAGTGATCTCGAGATCACTTCGTAGTAGAGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002227.1-387s1c1
Sequence:CCGGGCATGGAACCAACGACAATGACTCGAGTCATTGTCGTTGGTTCCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002227.1-572s1c1
Sequence:CCGGCCGAGCAGGATGGACATGATACTCGAGTATCATGTCCATCCTGCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002227.1-2927s1c1
Sequence:CCGGGCCTTAAGGAATATCTTCCAACTCGAGTTGGAAGATATTCCTTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A-431
TRC Version: 1 Clone ID:NM_002227.1-3102s1c1
Sequence:CCGGCTTCGGTTTAACCAAAGCAATCTCGAGATTGCTTTGGTTAAACCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002227.1-1148s1c1
Sequence:CCGGCTGAAATCACTCACATTGTAACTCGAGTTACAATGTGAGTGATTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002227.1-1384s1c1
Sequence:CCGGGCCATCAATAAATTGCGGCAACTCGAGTTGCCGCAATTTATTGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A-431
TRC Version: 1 Clone ID:NM_002227.1-1327s1c1
Sequence:CCGGCCGTTGATCGTCCACAACATACTCGAGTATGTTGTGGACGATCAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002227.1-2172s1c1
Sequence:CCGGCCATGGAAATGTGTGTACTAACTCGAGTTAGTACACACATTTCCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002227.1-1814s1c1
Sequence:CCGGGCACGAGAACACACATCTATTCTCGAGAATAGATGTGTGTTCTCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002227.1-693s1c1
Sequence:CCGGGCGATATATTCCAGAAACATTCTCGAGAATGTTTCTGGAATATATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A-431
TRC Version: 1 Clone ID:NM_002227.1-2817s1c1
Sequence:CCGGCGAGATCTTAAGGAACCTCTACTCGAGTAGAGGTTCCTTAAGATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002227.x-2869s1c1
Sequence:CCGGTGCACAGAAGACGGAGGAAATCTCGAGATTTCCTCCGTCTTCTGTGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002227.x-849s1c1
Sequence:CCGGCTTGGCTACCTTGGAAACTTTCTCGAGAAAGTTTCCAAGGTAGCCAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_002227.x-239s1c1
Sequence:CCGGCATGCCGTATCTCTCCTCTTTCTCGAGAAAGAGGAGAGATACGGCATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002227.x-2143s1c1
Sequence:CCGGCTGAGCTACTTGGAGGATAAACTCGAGTTTATCCTCCAAGTAGCTCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002227.x-898s1c1
Sequence:CCGGGAGACTTCCATGTTACTGATTCTCGAGAATCAGTAACATGGAAGTCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)