JAK1

Janus kinase 1

108 Gene Product Result for

Synonyms: JAK1A JAK1B JTK3

Species: Human JAK1(3716), Mouse Jak1(16451), Rat Jak1(84598), Zebrafish jak1(30280), domestic cat JAK1(101084377), Horse JAK1(100054008), cow JAK1(537201), dog JAK1(442952), chicken JAK1(395681), domestic guinea pig Jak1(100726895), naked mole-rat Jak1(101710283), sheep JAK1(101110716), Domestic Rabbit JAK1(100352594)

UniProtKB ID: P23458, Q59GQ2, Q9UD26

Gene ID:

Human(3716) Summary: Janus kinase 1 (JAK1), is a member of a new class of protein-tyrosine kinases (PTK) characterized by the presence of a second phosphotransferase-related domain immediately N-terminal to the PTK domain. The second phosphotransferase domain bears all the hallmarks of a protein kinase, although its structure differs significantly from that of the PTK and threonine/serine kinase family members. JAK1 is a large, widely expressed membrane-associated phosphoprotein. JAK1 is involved in the interferon-alpha/beta and -gamma signal transduction pathways. The reciprocal interdependence between JAK1 and TYK2 activities in the interferon-alpha pathway, and between JAK1 and JAK2 in the interferon-gamma pathway, may reflect a requirement for these kinases in the correct assembly of interferon receptor complexes. These kinases couple cytokine ligand binding to tyrosine phosphorylation of various known signaling proteins and of a unique family of transcription factors termed the signal transducers and activators of transcription, or STATs. [provided by RefSeq, Jul 2008]

Mouse(16451) Janus kinase 1

Rat(84598) Janus kinase 1

Zebrafish(30280) Janus kinase 1

domestic cat(101084377) Janus kinase 1

Horse(100054008) Janus kinase 1

cow(537201) Janus kinase 1

dog(442952) Janus kinase 1

chicken(395681) Janus kinase 1

domestic guinea pig(100726895) Janus kinase 1

naked mole-rat(101710283) Janus kinase 1

sheep(101110716) Janus kinase 1

Domestic Rabbit(100352594) Janus kinase 1

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

J1830	Anti-JAK1 (1026-1039) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution	human	western blot	pricing

SAB4300393	Anti-JAK1 (Ab-1022) antibody produced in rabbit affinity isolated antibody	rat, mouse, human	immunohistochemistry, western blot	pricing

06-272	Anti-JAK1 Antibody serum, clone, Upstate^®	human, hamster, mouse, rat, rabbit	immunoprecipitation (IP), western blot	pricing

AB3802	Anti-JAK1 Antibody serum, clone, Chemicon^®	human, rat, mouse	immunoprecipitation (IP), western blot	pricing

07-1485	Anti-JAK1 Antibody clone, from rabbit, purified by affinity chromatography	rat, mouse, human	western blot	pricing

SAB4501597	Anti-JAK1 antibody produced in rabbit affinity isolated antibody	mouse, rat, human	ELISA, immunohistochemistry, western blot	pricing

SAB4501598	Anti-JAK1 antibody produced in rabbit affinity isolated antibody	rat, human, mouse	ELISA, immunofluorescence, immunohistochemistry	pricing

05-1154	Anti-JAK1 Antibody, clone 73 clone 73, from mouse	rat, mouse, human, canine, chicken, Xenopus	immunofluorescence, immunoprecipitation (IP), western blot	pricing

SAB4504029	Anti-phospho-eIF4B (pSer⁴²²) antibody produced in rabbit affinity isolated antibody	rat, mouse, human	ELISA, immunofluorescence, immunohistochemistry, western blot	pricing

SAB4504446	Anti-phospho-JAK1 (pTyr¹⁰²²) antibody produced in rabbit affinity isolated antibody	mouse, rat, human	ELISA, immunohistochemistry, western blot	pricing

SAB4300123	Anti-phospho-JAK1 (pTyr¹⁰²²) antibody produced in rabbit affinity isolated antibody	human, mouse, rat	immunohistochemistry, western blot	pricing

07-849-I	Anti-phospho-JAK1 (Tyr1022/1023) clone, from rabbit, purified by affinity chromatography	human, human	dot blot, western blot	pricing

SAB5700389	Anti-Phospho-Jak1-Y1022/1023 antibody produced in rabbit	mouse, human	immunofluorescence, western blot	pricing

SAB1413085	Monoclonal Anti-JAK1 (phospho Y1022/Y1023) antibody produced in rabbit clone F11	human	flow cytometry	pricing

J3774	Monoclonal Anti-JAK1 antibody produced in mouse 2 mg/mL, clone JAK1-193, purified immunoglobulin, buffered aqueous solution	human, mouse, rat	ELISA, microarray, western blot	pricing

Small Molecule - Inhibitor

Product #	Description	Species	Add to Cart

PZ0304	PF-04965842 ≥98% (HPLC)	human	pricing

PZ0017	Tofacitinib citrate ≥98% (HPLC)	human	pricing

Proteins

Product #	Description	Species	Add to Cart

SRP0335	Jak1 active human recombinant, expressed in baculovirus infected Sf9 cells, ≥70% (SDS-PAGE)	human	pricing

14-918-M	JAK1 Protein, active, 10 µg Active, N-terminal GST-tagged, recombinant, human JAK1, amino acids 866-end, expressed by baculovirus in Sf21 insect cells. Activated in vitro by auto-phosphorylation. For use in Kinase Assays.	human	pricing

ELISA

Product #	Description	Species	Add to Cart

RAB0970	Phosphotyrosine JAK1 / Tyrosine-protein Kinase JAK1 ELISA Kit	human	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_002227	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_002227	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_002227	MISSION® shRNA Lentiviral Transduction Particles	human	pricing
SHCLNG-NM_146145	MISSION® shRNA Bacterial Glycerol Stock	mouse	pricing
SHCLND-NM_146145	MISSION® shRNA Plasmid DNA	mouse	pricing
SHCLNV-NM_146145	MISSION® shRNA Lentiviral Transduction Particles	mouse	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU084871	MISSION^® esiRNA targeting human JAK1	human	pricing

EMU084091	MISSION^® esiRNA targeting mouse Jak1	mouse	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_002227	siRNAs that have been validated in the lab	human	pricing
NM_053466	Rosetta Predictions	rat	pricing
NM_146145	Rosetta Predictions	mouse	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_002227	siRNAs that have been validated in the lab	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00174612 validated	1589
1	SASI_Hs01_00174613 validated	943
1	SASI_Hs01_00174614 validated	3090
2	SASI_Hs01_00174615 predicted	3634
3	SASI_Hs01_00174616 predicted	1537
4	SASI_Hs01_00174617 predicted	3731
5	SASI_Hs01_00174618 predicted	2491
6	SASI_Hs01_00174619 predicted	3757
7	SASI_Hs01_00174620 predicted	3237
8	SASI_Hs01_00174621 predicted	3115
9	SASI_Hs02_00333460 predicted	2520

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_053466	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn02_00266050 predicted	2653
2	SASI_Rn02_00266051 predicted	2807
3	SASI_Rn02_00266052 predicted	1851
4	SASI_Rn02_00266053 predicted	1418
5	SASI_Rn02_00266054 predicted	3207
6	SASI_Rn02_00266055 predicted	2780
7	SASI_Rn02_00266056 predicted	3117
8	SASI_Rn02_00266057 predicted	494
9	SASI_Rn02_00266058 predicted	1786
10	SASI_Rn02_00266059 predicted	1548

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_146145	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm01_00137469 predicted	2822
2	SASI_Mm02_00341833 predicted	2987
3	SASI_Mm01_00137470 predicted	953
4	SASI_Mm01_00137471 predicted	3383
5	SASI_Mm01_00137472 predicted	1571
6	SASI_Mm01_00137473 predicted	2957
7	SASI_Mm01_00137474 predicted	3367
8	SASI_Mm01_00137475 predicted	664
9	SASI_Mm01_00137477 predicted	529
10	SASI_Mm01_00137478 predicted	3298
11	SASI_Mm01_00137476 predicted	3492

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_002227 VALIDATED	JAK1 MISSION shRNA Bacterial Glycerol Stock Janus kinase 1	Human

26 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000121275
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.95	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002227.1-966s1c1
	Sequence:CCGGCGTTCTCTACTACGAAGTGATCTCGAGATCACTTCGTAGTAGAGAACGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121213
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002227.1-693s1c1
	Sequence:CCGGGCGATATATTCCAGAAACATTCTCGAGAATGTTTCTGGAATATATCGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121142
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.62	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002227.1-1384s1c1
	Sequence:CCGGGCCATCAATAAATTGCGGCAACTCGAGTTGCCGCAATTTATTGATGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121145
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_002227.1-2172s1c1
	Sequence:CCGGCCATGGAAATGTGTGTACTAACTCGAGTTAGTACACACATTTCCATGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121143
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.84	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002227.1-1814s1c1
	Sequence:CCGGGCACGAGAACACACATCTATTCTCGAGAATAGATGTGTGTTCTCGTGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121214
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.76	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002227.1-1148s1c1
	Sequence:CCGGCTGAAATCACTCACATTGTAACTCGAGTTACAATGTGAGTGATTTCAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121212
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: A-431
	TRC Version: 1	Clone ID:NM_002227.1-3102s1c1
	Sequence:CCGGCTTCGGTTTAACCAAAGCAATCTCGAGATTGCTTTGGTTAAACCGAAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121276
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.87	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002227.1-387s1c1
	Sequence:CCGGGCATGGAACCAACGACAATGACTCGAGTCATTGTCGTTGGTTCCATGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121272
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.92	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002227.1-572s1c1
	Sequence:CCGGCCGAGCAGGATGGACATGATACTCGAGTATCATGTCCATCCTGCTCGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121274
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002227.1-2927s1c1
	Sequence:CCGGGCCTTAAGGAATATCTTCCAACTCGAGTTGGAAGATATTCCTTAAGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121216
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.61	Cell Line: A-431
	TRC Version: 1	Clone ID:NM_002227.1-2817s1c1
	Sequence:CCGGCGAGATCTTAAGGAACCTCTACTCGAGTAGAGGTTCCTTAAGATCTCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000194761
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_002227.2-3676s1c1
	Sequence:CCGGCAGAACCTTATTGAAGGATTTCTCGAGAAATCCTTCAATAAGGTTCTGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196289
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_002227.2-3334s1c1
	Sequence:CCGGGAAACCGATAAGGAGTATTACCTCGAGGTAATACTCCTTATCGGTTTCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000295813
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.99	Cell Line: A549
	TRC Version: 2	Clone ID:NM_002227.2-1108s21c1
	Sequence:CCGGGAGACTTCCATGTTACTGATTCTCGAGAATCAGTAACATGGAAGTCTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000003105
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: A549
	TRC Version: 1	Clone ID:NM_002227.x-849s1c1
	Sequence:CCGGCTTGGCTACCTTGGAAACTTTCTCGAGAAAGTTTCCAAGGTAGCCAAGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000003103
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.56	Cell Line: A549
	TRC Version: 1	Clone ID:NM_002227.x-239s1c1
	Sequence:CCGGCATGCCGTATCTCTCCTCTTTCTCGAGAAAGAGGAGAGATACGGCATGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000003102
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.95	Cell Line: A549
	TRC Version: 1	Clone ID:NM_002227.x-898s1c1
	Sequence:CCGGGAGACTTCCATGTTACTGATTCTCGAGAATCAGTAACATGGAAGTCTCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121146
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.72	Cell Line: A-431
	TRC Version: 1	Clone ID:NM_002227.1-1327s1c1
	Sequence:CCGGCCGTTGATCGTCCACAACATACTCGAGTATGTTGTGGACGATCAACGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000010760
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.88	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002227.x-2869s1c1
	Sequence:CCGGTGCACAGAAGACGGAGGAAATCTCGAGATTTCCTCCGTCTTCTGTGCATTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000003104
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: A549
	TRC Version: 1	Clone ID:NM_002227.x-2143s1c1
	Sequence:CCGGCTGAGCTACTTGGAGGATAAACTCGAGTTTATCCTCCAAGTAGCTCAGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121215
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002227.1-3336s1c1
	Sequence:CCGGGACAGTCACAAGACTTGTGAACTCGAGTTCACAAGTCTTGTGACTGTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000295867
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.96	Cell Line: A549
	TRC Version: 2	Clone ID:NM_002227.2-2353s21c1
	Sequence:CCGGCTGAGCTACTTGGAGGATAAACTCGAGTTTATCCTCCAAGTAGCTCAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195042
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_002227.2-3738s1c1
	Sequence:CCGGCCACAGATTATCAAGTCCTTCCTCGAGGAAGGACTTGATAATCTGTGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195125
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_002227.2-3225s1c1
	Sequence:CCGGCTATTTGGGTTCTCGGCAATACTCGAGTATTGCCGAGAACCCAAATAGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000288591
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.96	Cell Line: A549
	TRC Version: 2	Clone ID:NM_002227.2-1176s21c1
	Sequence:CCGGCGTTCTCTACTACGAAGTGATCTCGAGATCACTTCGTAGTAGAGAACGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000295869
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.96	Cell Line: A549
	TRC Version: 2	Clone ID:NM_002227.2-3546s21c1
	Sequence:CCGGGACAGTCACAAGACTTGTGAACTCGAGTTCACAAGTCTTGTGACTGTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_002227 VALIDATED	JAK1 MISSION shRNA shRNA Plasmid DNA Janus kinase 1	Human

26 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000121275
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.95	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002227.1-966s1c1
	Sequence:CCGGCGTTCTCTACTACGAAGTGATCTCGAGATCACTTCGTAGTAGAGAACGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121213
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002227.1-693s1c1
	Sequence:CCGGGCGATATATTCCAGAAACATTCTCGAGAATGTTTCTGGAATATATCGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121142
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.62	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002227.1-1384s1c1
	Sequence:CCGGGCCATCAATAAATTGCGGCAACTCGAGTTGCCGCAATTTATTGATGGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121145
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_002227.1-2172s1c1
	Sequence:CCGGCCATGGAAATGTGTGTACTAACTCGAGTTAGTACACACATTTCCATGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121143
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.84	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002227.1-1814s1c1
	Sequence:CCGGGCACGAGAACACACATCTATTCTCGAGAATAGATGTGTGTTCTCGTGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121214
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.76	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002227.1-1148s1c1
	Sequence:CCGGCTGAAATCACTCACATTGTAACTCGAGTTACAATGTGAGTGATTTCAGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121212
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: A-431
	TRC Version: 1	Clone ID:NM_002227.1-3102s1c1
	Sequence:CCGGCTTCGGTTTAACCAAAGCAATCTCGAGATTGCTTTGGTTAAACCGAAGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121276
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.87	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002227.1-387s1c1
	Sequence:CCGGGCATGGAACCAACGACAATGACTCGAGTCATTGTCGTTGGTTCCATGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121272
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.92	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002227.1-572s1c1
	Sequence:CCGGCCGAGCAGGATGGACATGATACTCGAGTATCATGTCCATCCTGCTCGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121274
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002227.1-2927s1c1
	Sequence:CCGGGCCTTAAGGAATATCTTCCAACTCGAGTTGGAAGATATTCCTTAAGGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121216
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.61	Cell Line: A-431
	TRC Version: 1	Clone ID:NM_002227.1-2817s1c1
	Sequence:CCGGCGAGATCTTAAGGAACCTCTACTCGAGTAGAGGTTCCTTAAGATCTCGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000194761
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_002227.2-3676s1c1
	Sequence:CCGGCAGAACCTTATTGAAGGATTTCTCGAGAAATCCTTCAATAAGGTTCTGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000196289
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_002227.2-3334s1c1
	Sequence:CCGGGAAACCGATAAGGAGTATTACCTCGAGGTAATACTCCTTATCGGTTTCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000295813
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.99	Cell Line: A549
	TRC Version: 2	Clone ID:NM_002227.2-1108s21c1
	Sequence:CCGGGAGACTTCCATGTTACTGATTCTCGAGAATCAGTAACATGGAAGTCTCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000003105
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: A549
	TRC Version: 1	Clone ID:NM_002227.x-849s1c1
	Sequence:CCGGCTTGGCTACCTTGGAAACTTTCTCGAGAAAGTTTCCAAGGTAGCCAAGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000003103
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.56	Cell Line: A549
	TRC Version: 1	Clone ID:NM_002227.x-239s1c1
	Sequence:CCGGCATGCCGTATCTCTCCTCTTTCTCGAGAAAGAGGAGAGATACGGCATGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000003102
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.95	Cell Line: A549
	TRC Version: 1	Clone ID:NM_002227.x-898s1c1
	Sequence:CCGGGAGACTTCCATGTTACTGATTCTCGAGAATCAGTAACATGGAAGTCTCTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121146
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.72	Cell Line: A-431
	TRC Version: 1	Clone ID:NM_002227.1-1327s1c1
	Sequence:CCGGCCGTTGATCGTCCACAACATACTCGAGTATGTTGTGGACGATCAACGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000010760
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.88	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002227.x-2869s1c1
	Sequence:CCGGTGCACAGAAGACGGAGGAAATCTCGAGATTTCCTCCGTCTTCTGTGCATTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000003104
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: A549
	TRC Version: 1	Clone ID:NM_002227.x-2143s1c1
	Sequence:CCGGCTGAGCTACTTGGAGGATAAACTCGAGTTTATCCTCCAAGTAGCTCAGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121215
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002227.1-3336s1c1
	Sequence:CCGGGACAGTCACAAGACTTGTGAACTCGAGTTCACAAGTCTTGTGACTGTCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000295867
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.96	Cell Line: A549
	TRC Version: 2	Clone ID:NM_002227.2-2353s21c1
	Sequence:CCGGCTGAGCTACTTGGAGGATAAACTCGAGTTTATCCTCCAAGTAGCTCAGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000195042
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_002227.2-3738s1c1
	Sequence:CCGGCCACAGATTATCAAGTCCTTCCTCGAGGAAGGACTTGATAATCTGTGGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000195125
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_002227.2-3225s1c1
	Sequence:CCGGCTATTTGGGTTCTCGGCAATACTCGAGTATTGCCGAGAACCCAAATAGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000288591
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.96	Cell Line: A549
	TRC Version: 2	Clone ID:NM_002227.2-1176s21c1
	Sequence:CCGGCGTTCTCTACTACGAAGTGATCTCGAGATCACTTCGTAGTAGAGAACGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000295869
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.96	Cell Line: A549
	TRC Version: 2	Clone ID:NM_002227.2-3546s21c1
	Sequence:CCGGGACAGTCACAAGACTTGTGAACTCGAGTTCACAAGTCTTGTGACTGTCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_002227 VALIDATED	JAK1 MISSION shRNA Lentiviral Transduction Particles Janus kinase 1	Human

26 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000121275
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.95	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002227.1-966s1c1
	Sequence:CCGGCGTTCTCTACTACGAAGTGATCTCGAGATCACTTCGTAGTAGAGAACGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121213
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002227.1-693s1c1
	Sequence:CCGGGCGATATATTCCAGAAACATTCTCGAGAATGTTTCTGGAATATATCGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121142
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.62	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002227.1-1384s1c1
	Sequence:CCGGGCCATCAATAAATTGCGGCAACTCGAGTTGCCGCAATTTATTGATGGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121145
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_002227.1-2172s1c1
	Sequence:CCGGCCATGGAAATGTGTGTACTAACTCGAGTTAGTACACACATTTCCATGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121143
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.84	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002227.1-1814s1c1
	Sequence:CCGGGCACGAGAACACACATCTATTCTCGAGAATAGATGTGTGTTCTCGTGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121214
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.76	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002227.1-1148s1c1
	Sequence:CCGGCTGAAATCACTCACATTGTAACTCGAGTTACAATGTGAGTGATTTCAGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121212
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: A-431
	TRC Version: 1	Clone ID:NM_002227.1-3102s1c1
	Sequence:CCGGCTTCGGTTTAACCAAAGCAATCTCGAGATTGCTTTGGTTAAACCGAAGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121276
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.87	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002227.1-387s1c1
	Sequence:CCGGGCATGGAACCAACGACAATGACTCGAGTCATTGTCGTTGGTTCCATGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121272
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.92	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002227.1-572s1c1
	Sequence:CCGGCCGAGCAGGATGGACATGATACTCGAGTATCATGTCCATCCTGCTCGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121274
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002227.1-2927s1c1
	Sequence:CCGGGCCTTAAGGAATATCTTCCAACTCGAGTTGGAAGATATTCCTTAAGGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121216
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.61	Cell Line: A-431
	TRC Version: 1	Clone ID:NM_002227.1-2817s1c1
	Sequence:CCGGCGAGATCTTAAGGAACCTCTACTCGAGTAGAGGTTCCTTAAGATCTCGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000194761
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_002227.2-3676s1c1
	Sequence:CCGGCAGAACCTTATTGAAGGATTTCTCGAGAAATCCTTCAATAAGGTTCTGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196289
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_002227.2-3334s1c1
	Sequence:CCGGGAAACCGATAAGGAGTATTACCTCGAGGTAATACTCCTTATCGGTTTCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000295813
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.99	Cell Line: A549
	TRC Version: 2	Clone ID:NM_002227.2-1108s21c1
	Sequence:CCGGGAGACTTCCATGTTACTGATTCTCGAGAATCAGTAACATGGAAGTCTCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000003105
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: A549
	TRC Version: 1	Clone ID:NM_002227.x-849s1c1
	Sequence:CCGGCTTGGCTACCTTGGAAACTTTCTCGAGAAAGTTTCCAAGGTAGCCAAGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000003103
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.56	Cell Line: A549
	TRC Version: 1	Clone ID:NM_002227.x-239s1c1
	Sequence:CCGGCATGCCGTATCTCTCCTCTTTCTCGAGAAAGAGGAGAGATACGGCATGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000003102
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.95	Cell Line: A549
	TRC Version: 1	Clone ID:NM_002227.x-898s1c1
	Sequence:CCGGGAGACTTCCATGTTACTGATTCTCGAGAATCAGTAACATGGAAGTCTCTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121146
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.72	Cell Line: A-431
	TRC Version: 1	Clone ID:NM_002227.1-1327s1c1
	Sequence:CCGGCCGTTGATCGTCCACAACATACTCGAGTATGTTGTGGACGATCAACGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000010760
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.88	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002227.x-2869s1c1
	Sequence:CCGGTGCACAGAAGACGGAGGAAATCTCGAGATTTCCTCCGTCTTCTGTGCATTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000003104
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: A549
	TRC Version: 1	Clone ID:NM_002227.x-2143s1c1
	Sequence:CCGGCTGAGCTACTTGGAGGATAAACTCGAGTTTATCCTCCAAGTAGCTCAGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121215
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002227.1-3336s1c1
	Sequence:CCGGGACAGTCACAAGACTTGTGAACTCGAGTTCACAAGTCTTGTGACTGTCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000295867
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.96	Cell Line: A549
	TRC Version: 2	Clone ID:NM_002227.2-2353s21c1
	Sequence:CCGGCTGAGCTACTTGGAGGATAAACTCGAGTTTATCCTCCAAGTAGCTCAGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195042
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_002227.2-3738s1c1
	Sequence:CCGGCCACAGATTATCAAGTCCTTCCTCGAGGAAGGACTTGATAATCTGTGGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195125
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_002227.2-3225s1c1
	Sequence:CCGGCTATTTGGGTTCTCGGCAATACTCGAGTATTGCCGAGAACCCAAATAGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000288591
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.96	Cell Line: A549
	TRC Version: 2	Clone ID:NM_002227.2-1176s21c1
	Sequence:CCGGCGTTCTCTACTACGAAGTGATCTCGAGATCACTTCGTAGTAGAGAACGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000295869
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.96	Cell Line: A549
	TRC Version: 2	Clone ID:NM_002227.2-3546s21c1
	Sequence:CCGGGACAGTCACAAGACTTGTGAACTCGAGTTCACAAGTCTTGTGACTGTCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_146145 VALIDATED	JAK1 MISSION shRNA Bacterial Glycerol Stock Janus kinase 1	Mouse

8 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000321914
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_146145.2-1018s21c1
	Sequence:CCGGTCTTACCAGGATGCGAATAAACTCGAGTTTATTCGCATCCTGGTAAGATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023289
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_146145.1-1600s1c1
	Sequence:CCGGGCACAGAATATGCCATCAATACTCGAGTATTGATGGCATATTCTGTGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023290
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_146145.1-2364s1c1
	Sequence:CCGGGCCCTGAGTTACTTGGAAGATCTCGAGATCTTCCAAGTAACTCAGGGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023292
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.89	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_146145.1-1589s1c1
	Sequence:CCGGCGGTCCAATCTGCACAGAATACTCGAGTATTCTGTGCAGATTGGACCGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023293
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.73	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_146145.1-3412s1c1
	Sequence:CCGGCGGAATGTTTAATCCAGTGTACTCGAGTACACTGGATTAAACATTCCGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000321983
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_146145.2-3462s21c1
	Sequence:CCGGCGGAATGTTTAATCCAGTGTACTCGAGTACACTGGATTAAACATTCCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000321912
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_146145.2-2414s21c1
	Sequence:CCGGGCCCTGAGTTACTTGGAAGATCTCGAGATCTTCCAAGTAACTCAGGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000321911
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_146145.2-1639s21c1
	Sequence:CCGGCGGTCCAATCTGCACAGAATACTCGAGTATTCTGTGCAGATTGGACCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_146145 VALIDATED	JAK1 MISSION shRNA shRNA Plasmid DNA Janus kinase 1	Mouse

8 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000321914
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_146145.2-1018s21c1
	Sequence:CCGGTCTTACCAGGATGCGAATAAACTCGAGTTTATTCGCATCCTGGTAAGATTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000023289
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_146145.1-1600s1c1
	Sequence:CCGGGCACAGAATATGCCATCAATACTCGAGTATTGATGGCATATTCTGTGCTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000023290
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_146145.1-2364s1c1
	Sequence:CCGGGCCCTGAGTTACTTGGAAGATCTCGAGATCTTCCAAGTAACTCAGGGCTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000023292
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.89	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_146145.1-1589s1c1
	Sequence:CCGGCGGTCCAATCTGCACAGAATACTCGAGTATTCTGTGCAGATTGGACCGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000023293
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.73	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_146145.1-3412s1c1
	Sequence:CCGGCGGAATGTTTAATCCAGTGTACTCGAGTACACTGGATTAAACATTCCGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000321983
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_146145.2-3462s21c1
	Sequence:CCGGCGGAATGTTTAATCCAGTGTACTCGAGTACACTGGATTAAACATTCCGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000321912
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_146145.2-2414s21c1
	Sequence:CCGGGCCCTGAGTTACTTGGAAGATCTCGAGATCTTCCAAGTAACTCAGGGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000321911
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_146145.2-1639s21c1
	Sequence:CCGGCGGTCCAATCTGCACAGAATACTCGAGTATTCTGTGCAGATTGGACCGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_146145 VALIDATED	JAK1 MISSION shRNA Lentiviral Transduction Particles Janus kinase 1	Mouse

8 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000321914
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_146145.2-1018s21c1
	Sequence:CCGGTCTTACCAGGATGCGAATAAACTCGAGTTTATTCGCATCCTGGTAAGATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023289
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_146145.1-1600s1c1
	Sequence:CCGGGCACAGAATATGCCATCAATACTCGAGTATTGATGGCATATTCTGTGCTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023290
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_146145.1-2364s1c1
	Sequence:CCGGGCCCTGAGTTACTTGGAAGATCTCGAGATCTTCCAAGTAACTCAGGGCTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023292
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.89	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_146145.1-1589s1c1
	Sequence:CCGGCGGTCCAATCTGCACAGAATACTCGAGTATTCTGTGCAGATTGGACCGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023293
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.73	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_146145.1-3412s1c1
	Sequence:CCGGCGGAATGTTTAATCCAGTGTACTCGAGTACACTGGATTAAACATTCCGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000321983
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_146145.2-3462s21c1
	Sequence:CCGGCGGAATGTTTAATCCAGTGTACTCGAGTACACTGGATTAAACATTCCGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000321912
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_146145.2-2414s21c1
	Sequence:CCGGGCCCTGAGTTACTTGGAAGATCTCGAGATCTTCCAAGTAACTCAGGGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000321911
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_146145.2-1639s21c1
	Sequence:CCGGCGGTCCAATCTGCACAGAATACTCGAGTATTCTGTGCAGATTGGACCGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart