EMAIL THIS PAGE TO A FRIEND

JAK2

Janus kinase 2

170 Gene Product Result for
Synonyms: JTK10 THCYT3
UniProtKB ID: O60674, O14636, O75297
Gene ID:
Human(3717) Summary: This gene product is a protein tyrosine kinase involved in a specific subset of cytokine receptor signaling pathways. It has been found to be constituitively associated with the prolactin receptor and is required for responses to gamma interferon. Mice that do not express an active protein for this gene exhibit embryonic lethality associated with the absence of definitive erythropoiesis. [provided by RefSeq, Jul 2008]
Mouse(16452) Janus kinase 2
Rat(24514) Janus kinase 2
sheep(101113909) Janus kinase 2
naked mole-rat(101717708) Janus kinase 2
chicken(374199) Janus kinase 2
cow(525246) Janus kinase 2
domestic cat(101088959) Janus kinase 2
dog(484185) Janus kinase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
J2080 Anti-JAK2 (1001-1015) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
J1955 Anti-JAK2 (561-575) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4300394 Anti-JAK2 (Ab-1007) antibody produced in rabbit affinity isolated antibody rat, human, mouse
western blot pricing
SAB4300587 Anti-JAK2 (Ab-570) antibody produced in rabbit affinity isolated antibody rat, human
immunohistochemistry pricing
SAB2501574 Anti-JAK2 (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
HPA040820 Anti-JAK2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4501599 Anti-JAK2 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, western blot pricing
SAB4501600 Anti-JAK2 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4501601 Anti-JAK2 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4501602 Anti-JAK2 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry pricing
HPA043870 Anti-JAK2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
SAB4300124 Anti-phospho-JAK2 (pTyr1007) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry, western blot pricing
SAB4504447 Anti-phospho-JAK2 (pTyr1007) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry pricing
SAB4504448 Anti-phospho-JAK2 (pTyr221) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4503928 Anti-phospho-JAK2 (pTyr570) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4301238 Anti-phospho-JAK2 (pTyr570) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4504614 Anti-phospho-JAK2 (pTyr931) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301431 Anti-phospho-JAK2 (pTyr931) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4200483 Monoclonal Anti-JAK2 antibody produced in mouse ~1.0 mg/mL, clone 10.1.5, purified immunoglobulin bovine, human
immunofluorescence, western blot pricing
SAB5300075 Monoclonal Anti-JAK2 antibody produced in mouse clone 1C1, ascites fluid human
ELISA, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
T3434 Tyrphostin AG 490 solid human pricing

ELISA

Product # Description Species Add to Cart
 
RAB0971 Phosphotyrosine JAK2 / Tyrosine-protein Kinase JAK2 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004972 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004972 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004972 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008413 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008413 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008413 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004972 Rosetta Predictions human pricing
NM_031514 Rosetta Predictions rat pricing
NM_001048177 Rosetta Predictions mouse pricing
NM_008413 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004972 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338675 predicted 2439
2 SASI_Hs01_00041547 predicted 2966
3 SASI_Hs01_00041548 predicted 2555
4 SASI_Hs01_00041550 predicted 3288
5 SASI_Hs01_00041551 predicted 1543
6 SASI_Hs01_00041552 predicted 616
7 SASI_Hs01_00041553 predicted 1201
8 SASI_Hs01_00041554 predicted 825
9 SASI_Hs01_00041555 predicted 1042
10 SASI_Hs02_00338676 predicted 1742
11 SASI_Hs01_00041549 predicted 2493
12 SASI_Hs01_00041556 predicted 1693
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031514 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091611 predicted 944
2 SASI_Rn01_00091612 predicted 802
3 SASI_Rn01_00091613 predicted 3336
4 SASI_Rn01_00091614 predicted 3088
5 SASI_Rn01_00091615 predicted 1253
6 SASI_Rn01_00091616 predicted 1084
7 SASI_Rn01_00091617 predicted 3374
8 SASI_Rn01_00091618 predicted 2920
9 SASI_Rn02_00264640 predicted 1205
10 SASI_Rn01_00091619 predicted 538
11 SASI_Rn01_00091620 predicted 1422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048177 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292130 predicted 536
2 SASI_Mm02_00292131 predicted 1105
3 SASI_Mm02_00292132 predicted 2600
4 SASI_Mm02_00292133 predicted 3498
5 SASI_Mm02_00292134 predicted 2735
6 SASI_Mm02_00292135 predicted 1411
7 SASI_Mm02_00292136 predicted 2401
8 SASI_Mm02_00292137 predicted 2423
9 SASI_Mm02_00292138 predicted 3109
10 SASI_Mm02_00292139 predicted 1369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008413 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176770 predicted 621
2 SASI_Mm01_00176771 predicted 1181
3 SASI_Mm01_00176772 predicted 2687
4 SASI_Mm01_00176773 predicted 3586
5 SASI_Mm01_00176774 predicted 2811
6 SASI_Mm01_00176775 predicted 1490
7 SASI_Mm01_00176776 predicted 2479
8 SASI_Mm01_00176777 predicted 2504
9 SASI_Mm01_00176778 predicted 3189
10 SASI_Mm01_00176779 predicted 1445
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004972
VALIDATED
JAK2 MISSION shRNA Bacterial Glycerol Stock
Janus kinase 2
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004972.3-2586s21c1
Sequence:GTACCGGAGTGATCCTGGCATTAGTATTCTCGAGAATACTAATGCCAGGATCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196656    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004972.2-4773s1c1
Sequence:CCGGGCCAATAACATTCTTCGATCTCTCGAGAGATCGAAGAATGTTATTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_004972.2-3669s1c1
Sequence:CCGGGCGGAATTTATGCGTATGATTCTCGAGAATCATACGCATAAATTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004972.3-4564s21c1
Sequence:CCGGCCCTGACCCTAAATAATACATCTCGAGATGTATTATTTAGGGTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004972.3-1578s21c1
Sequence:CCGGGCTTTGTCTTTCGTGTCATTACTCGAGTAATGACACGAAAGACAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004972.3-3053s21c1
Sequence:GTACCGGGCAACTTGGCAAGGGTAATTTCTCGAGAAATTACCCTTGCCAAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004972.2-2892s1c1
Sequence:CCGGGCCATCATACGAGATCTTAACCTCGAGGTTAAGATCTCGTATGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004972.3-3019s21c1
Sequence:CCGGCACAGTTTGAAGAGAGACATTCTCGAGAATGTCTCTCTTCAAACTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004972.x-1039s1c1
Sequence:CCGGCAGTGTTAGATATGATGAGAACTCGAGTTCTCATCATATCTAACACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004972.x-1578s1c1
Sequence:CCGGGCTTTGTCTTTCGTGTCATTACTCGAGTAATGACACGAAAGACAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003178    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004972.x-4564s1c1
Sequence:CCGGCCCTGACCCTAAATAATACATCTCGAGATGTATTATTTAGGGTCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004972.x-2826s1c1
Sequence:CCGGGCAGAATTAGCAAACCTTATACTCGAGTATAAGGTTTGCTAATTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004972.x-3019s1c1
Sequence:CCGGCACAGTTTGAAGAGAGACATTCTCGAGAATGTCTCTCTTCAAACTGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004972.3-2826s21c1
Sequence:CCGGGCAGAATTAGCAAACCTTATACTCGAGTATAAGGTTTGCTAATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004972
VALIDATED
JAK2 MISSION shRNA shRNA Plasmid DNA
Janus kinase 2
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004972.3-2586s21c1
Sequence:GTACCGGAGTGATCCTGGCATTAGTATTCTCGAGAATACTAATGCCAGGATCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196656    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004972.2-4773s1c1
Sequence:CCGGGCCAATAACATTCTTCGATCTCTCGAGAGATCGAAGAATGTTATTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_004972.2-3669s1c1
Sequence:CCGGGCGGAATTTATGCGTATGATTCTCGAGAATCATACGCATAAATTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004972.3-4564s21c1
Sequence:CCGGCCCTGACCCTAAATAATACATCTCGAGATGTATTATTTAGGGTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004972.3-1578s21c1
Sequence:CCGGGCTTTGTCTTTCGTGTCATTACTCGAGTAATGACACGAAAGACAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004972.3-3053s21c1
Sequence:GTACCGGGCAACTTGGCAAGGGTAATTTCTCGAGAAATTACCCTTGCCAAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004972.2-2892s1c1
Sequence:CCGGGCCATCATACGAGATCTTAACCTCGAGGTTAAGATCTCGTATGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004972.3-3019s21c1
Sequence:CCGGCACAGTTTGAAGAGAGACATTCTCGAGAATGTCTCTCTTCAAACTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004972.x-1039s1c1
Sequence:CCGGCAGTGTTAGATATGATGAGAACTCGAGTTCTCATCATATCTAACACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004972.x-1578s1c1
Sequence:CCGGGCTTTGTCTTTCGTGTCATTACTCGAGTAATGACACGAAAGACAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003178    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004972.x-4564s1c1
Sequence:CCGGCCCTGACCCTAAATAATACATCTCGAGATGTATTATTTAGGGTCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004972.x-2826s1c1
Sequence:CCGGGCAGAATTAGCAAACCTTATACTCGAGTATAAGGTTTGCTAATTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004972.x-3019s1c1
Sequence:CCGGCACAGTTTGAAGAGAGACATTCTCGAGAATGTCTCTCTTCAAACTGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004972.3-2826s21c1
Sequence:CCGGGCAGAATTAGCAAACCTTATACTCGAGTATAAGGTTTGCTAATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004972
VALIDATED
JAK2 MISSION shRNA Lentiviral Transduction Particles
Janus kinase 2
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004972.3-2586s21c1
Sequence:GTACCGGAGTGATCCTGGCATTAGTATTCTCGAGAATACTAATGCCAGGATCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196656    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004972.2-4773s1c1
Sequence:CCGGGCCAATAACATTCTTCGATCTCTCGAGAGATCGAAGAATGTTATTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_004972.2-3669s1c1
Sequence:CCGGGCGGAATTTATGCGTATGATTCTCGAGAATCATACGCATAAATTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004972.3-4564s21c1
Sequence:CCGGCCCTGACCCTAAATAATACATCTCGAGATGTATTATTTAGGGTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004972.3-1578s21c1
Sequence:CCGGGCTTTGTCTTTCGTGTCATTACTCGAGTAATGACACGAAAGACAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004972.3-3053s21c1
Sequence:GTACCGGGCAACTTGGCAAGGGTAATTTCTCGAGAAATTACCCTTGCCAAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004972.2-2892s1c1
Sequence:CCGGGCCATCATACGAGATCTTAACCTCGAGGTTAAGATCTCGTATGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004972.3-3019s21c1
Sequence:CCGGCACAGTTTGAAGAGAGACATTCTCGAGAATGTCTCTCTTCAAACTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004972.x-1039s1c1
Sequence:CCGGCAGTGTTAGATATGATGAGAACTCGAGTTCTCATCATATCTAACACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004972.x-1578s1c1
Sequence:CCGGGCTTTGTCTTTCGTGTCATTACTCGAGTAATGACACGAAAGACAAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003178    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004972.x-4564s1c1
Sequence:CCGGCCCTGACCCTAAATAATACATCTCGAGATGTATTATTTAGGGTCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004972.x-2826s1c1
Sequence:CCGGGCAGAATTAGCAAACCTTATACTCGAGTATAAGGTTTGCTAATTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004972.x-3019s1c1
Sequence:CCGGCACAGTTTGAAGAGAGACATTCTCGAGAATGTCTCTCTTCAAACTGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004972.3-2826s21c1
Sequence:CCGGGCAGAATTAGCAAACCTTATACTCGAGTATAAGGTTTGCTAATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008413
VALIDATED
JAK2 MISSION shRNA Bacterial Glycerol Stock
Janus kinase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008413.2-3327s21c1
Sequence:CCGGCCTGGCAACAAGGAACATATTCTCGAGAATATGTTCCTTGTTGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008413.2-3573s21c1
Sequence:CCGGCGTGGAATTTATGCGAATGATCTCGAGATCATTCGCATAAATTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008413.2-1969s21c1
Sequence:CCGGCCAACATTACAGAGGCATAATCTCGAGATTATGCCTCTGTAATGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008413.2-1602s21c1
Sequence:CCGGCGGCCCAATATCAATGGATTTCTCGAGAAATCCATTGATATTGGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008413.2-2805s21c1
Sequence:CCGGCCGTGATCTTAACAGCCTGTTCTCGAGAACAGGCTGTTAAGATCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008413.1-3021s1c1
Sequence:CCGGCCTGGCAACAAGGAACATATTCTCGAGAATATGTTCCTTGTTGCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008413.1-2499s1c1
Sequence:CCGGCCGTGATCTTAACAGCCTGTTCTCGAGAACAGGCTGTTAAGATCACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008413.1-1296s1c1
Sequence:CCGGCGGCCCAATATCAATGGATTTCTCGAGAAATCCATTGATATTGGGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008413.1-3267s1c1
Sequence:CCGGCGTGGAATTTATGCGAATGATCTCGAGATCATTCGCATAAATTCCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008413
VALIDATED
JAK2 MISSION shRNA shRNA Plasmid DNA
Janus kinase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008413.2-3327s21c1
Sequence:CCGGCCTGGCAACAAGGAACATATTCTCGAGAATATGTTCCTTGTTGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008413.2-3573s21c1
Sequence:CCGGCGTGGAATTTATGCGAATGATCTCGAGATCATTCGCATAAATTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008413.2-1969s21c1
Sequence:CCGGCCAACATTACAGAGGCATAATCTCGAGATTATGCCTCTGTAATGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008413.2-1602s21c1
Sequence:CCGGCGGCCCAATATCAATGGATTTCTCGAGAAATCCATTGATATTGGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008413.2-2805s21c1
Sequence:CCGGCCGTGATCTTAACAGCCTGTTCTCGAGAACAGGCTGTTAAGATCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008413.1-3021s1c1
Sequence:CCGGCCTGGCAACAAGGAACATATTCTCGAGAATATGTTCCTTGTTGCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008413.1-2499s1c1
Sequence:CCGGCCGTGATCTTAACAGCCTGTTCTCGAGAACAGGCTGTTAAGATCACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008413.1-1296s1c1
Sequence:CCGGCGGCCCAATATCAATGGATTTCTCGAGAAATCCATTGATATTGGGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008413.1-3267s1c1
Sequence:CCGGCGTGGAATTTATGCGAATGATCTCGAGATCATTCGCATAAATTCCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008413
VALIDATED
JAK2 MISSION shRNA Lentiviral Transduction Particles
Janus kinase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008413.2-3327s21c1
Sequence:CCGGCCTGGCAACAAGGAACATATTCTCGAGAATATGTTCCTTGTTGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008413.2-3573s21c1
Sequence:CCGGCGTGGAATTTATGCGAATGATCTCGAGATCATTCGCATAAATTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008413.2-1969s21c1
Sequence:CCGGCCAACATTACAGAGGCATAATCTCGAGATTATGCCTCTGTAATGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008413.2-1602s21c1
Sequence:CCGGCGGCCCAATATCAATGGATTTCTCGAGAAATCCATTGATATTGGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008413.2-2805s21c1
Sequence:CCGGCCGTGATCTTAACAGCCTGTTCTCGAGAACAGGCTGTTAAGATCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008413.1-3021s1c1
Sequence:CCGGCCTGGCAACAAGGAACATATTCTCGAGAATATGTTCCTTGTTGCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008413.1-2499s1c1
Sequence:CCGGCCGTGATCTTAACAGCCTGTTCTCGAGAACAGGCTGTTAAGATCACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008413.1-1296s1c1
Sequence:CCGGCGGCCCAATATCAATGGATTTCTCGAGAAATCCATTGATATTGGGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008413.1-3267s1c1
Sequence:CCGGCGTGGAATTTATGCGAATGATCTCGAGATCATTCGCATAAATTCCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)