EMAIL THIS PAGE TO A FRIEND

JAK3

Janus kinase 3

85 Gene Product Result for
Synonyms: JAK-3 JAK3_HUMAN JAKL L-JAK LJAK
UniProtKB ID: P52333, Q13259, Q13260, Q13611, Q99699, Q9Y6S2
Gene ID:
Human(3718) Summary: The protein encoded by this gene is a member of the Janus kinase (JAK) family of tyrosine kinases involved in cytokine receptor-mediated intracellular signal transduction. It is predominantly expressed in immune cells and transduces a signal in response to its activation via tyrosine phosphorylation by interleukin receptors. Mutations in this gene are associated with autosomal SCID (severe combined immunodeficiency disease). [provided by RefSeq, Jul 2008]
Mouse(16453) Janus kinase 3
Rat(25326) Janus kinase 3
Zebrafish(561370) Janus kinase 3 (a protein tyrosine kinase, leukocyte)
chicken(395845) Janus kinase 3
dog(610004) Janus kinase 3
cow(538276) Janus kinase 3
Horse(100147451) Janus kinase 3
domestic cat(493680) Janus kinase 3
domestic cat(101092339) Janus kinase 3
naked mole-rat(101715472) Janus kinase 3
sheep(101112816) Janus kinase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
Z4626 ZM 39923 hydrochloride >98% (HPLC) human pricing

ELISA

Product # Description Species Add to Cart
 
RAB0972 Phosphotyrosine JAK3 / Tyrosine-protein Kinase JAK3 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010589 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010589 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010589 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000215 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000215 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000215 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000215 Rosetta Predictions human pricing
NM_012855 Rosetta Predictions rat pricing
NM_010589 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000215 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118128 predicted 2992
2 SASI_Hs02_00302103 predicted 1618
3 SASI_Hs01_00118129 predicted 1779
4 SASI_Hs01_00118130 predicted 1606
5 SASI_Hs01_00118131 predicted 562
6 SASI_Hs01_00118132 predicted 975
7 SASI_Hs01_00118133 predicted 1916
8 SASI_Hs01_00118134 predicted 2282
9 SASI_Hs01_00118135 predicted 2611
10 SASI_Hs01_00118136 predicted 456
11 SASI_Hs01_00118137 predicted 2716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012855 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093729 predicted 1111
2 SASI_Rn01_00093730 predicted 748
3 SASI_Rn01_00093731 predicted 1698
4 SASI_Rn01_00093732 predicted 2935
5 SASI_Rn01_00093733 predicted 766
6 SASI_Rn01_00093734 predicted 1764
7 SASI_Rn01_00093735 predicted 1946
8 SASI_Rn01_00093736 predicted 1354
9 SASI_Rn01_00093737 predicted 3133
10 SASI_Rn01_00093738 predicted 3113
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010589 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156663 predicted 1718
2 SASI_Mm02_00318890 predicted 390
3 SASI_Mm01_00156664 predicted 2459
4 SASI_Mm01_00156667 predicted 2616
5 SASI_Mm01_00156668 predicted 2257
6 SASI_Mm01_00156669 predicted 2044
7 SASI_Mm01_00156670 predicted 1219
8 SASI_Mm01_00156671 predicted 478
9 SASI_Mm02_00318891 predicted 2207
10 SASI_Mm01_00156672 predicted 885
11 SASI_Mm01_00156665 predicted 1791
12 SASI_Mm01_00156666 predicted 3106
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010589
VALIDATED
JAK3 MISSION shRNA Bacterial Glycerol Stock
Janus kinase 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010589.5-2341s21c1
Sequence:CCGGCGGCCTCATTACATCAGATTACTCGAGTAATCTGATGTAATGAGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010589.3-271s1c1
Sequence:CCGGCCAAGCCACATCTTCTGCATACTCGAGTATGCAGAAGATGTGGCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010589.3-2002s1c1
Sequence:CCGGCCTTTCATTAAGCTGAGTGATCTCGAGATCACTCAGCTTAATGAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010589.3-2616s1c1
Sequence:CCGGGCGGGAGATTCAGATCCTTAACTCGAGTTAAGGATCTGAATCTCCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010589.3-2343s1c1
Sequence:CCGGCGGCCTCATTACATCAGATTACTCGAGTAATCTGATGTAATGAGGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010589.3-135s1c1
Sequence:CCGGCCAGCGATTGTCATTCTCTTTCTCGAGAAAGAGAATGACAATCGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010589.5-715s21c1
Sequence:CCGGCGCGCTCATGGCCAAGTATATCTCGAGATATACTTGGCCATGAGCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010589.5-2456s21c1
Sequence:CCGGTTCGAGGAGAGACACCTTAAGCTCGAGCTTAAGGTGTCTCTCCTCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010589.5-269s21c1
Sequence:CCGGCCAAGCCACATCTTCTGCATACTCGAGTATGCAGAAGATGTGGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010589.5-1066s21c1
Sequence:CCGGCTGCGACTCCAGGCATTATTTCTCGAGAAATAATGCCTGGAGTCGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010589
VALIDATED
JAK3 MISSION shRNA shRNA Plasmid DNA
Janus kinase 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010589.5-2341s21c1
Sequence:CCGGCGGCCTCATTACATCAGATTACTCGAGTAATCTGATGTAATGAGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010589.3-271s1c1
Sequence:CCGGCCAAGCCACATCTTCTGCATACTCGAGTATGCAGAAGATGTGGCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010589.3-2002s1c1
Sequence:CCGGCCTTTCATTAAGCTGAGTGATCTCGAGATCACTCAGCTTAATGAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010589.3-2616s1c1
Sequence:CCGGGCGGGAGATTCAGATCCTTAACTCGAGTTAAGGATCTGAATCTCCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010589.3-2343s1c1
Sequence:CCGGCGGCCTCATTACATCAGATTACTCGAGTAATCTGATGTAATGAGGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010589.3-135s1c1
Sequence:CCGGCCAGCGATTGTCATTCTCTTTCTCGAGAAAGAGAATGACAATCGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010589.5-715s21c1
Sequence:CCGGCGCGCTCATGGCCAAGTATATCTCGAGATATACTTGGCCATGAGCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010589.5-2456s21c1
Sequence:CCGGTTCGAGGAGAGACACCTTAAGCTCGAGCTTAAGGTGTCTCTCCTCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010589.5-269s21c1
Sequence:CCGGCCAAGCCACATCTTCTGCATACTCGAGTATGCAGAAGATGTGGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010589.5-1066s21c1
Sequence:CCGGCTGCGACTCCAGGCATTATTTCTCGAGAAATAATGCCTGGAGTCGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010589
VALIDATED
JAK3 MISSION shRNA Lentiviral Transduction Particles
Janus kinase 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010589.5-2341s21c1
Sequence:CCGGCGGCCTCATTACATCAGATTACTCGAGTAATCTGATGTAATGAGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010589.3-271s1c1
Sequence:CCGGCCAAGCCACATCTTCTGCATACTCGAGTATGCAGAAGATGTGGCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010589.3-2002s1c1
Sequence:CCGGCCTTTCATTAAGCTGAGTGATCTCGAGATCACTCAGCTTAATGAAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010589.3-2616s1c1
Sequence:CCGGGCGGGAGATTCAGATCCTTAACTCGAGTTAAGGATCTGAATCTCCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010589.3-2343s1c1
Sequence:CCGGCGGCCTCATTACATCAGATTACTCGAGTAATCTGATGTAATGAGGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010589.3-135s1c1
Sequence:CCGGCCAGCGATTGTCATTCTCTTTCTCGAGAAAGAGAATGACAATCGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010589.5-715s21c1
Sequence:CCGGCGCGCTCATGGCCAAGTATATCTCGAGATATACTTGGCCATGAGCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010589.5-2456s21c1
Sequence:CCGGTTCGAGGAGAGACACCTTAAGCTCGAGCTTAAGGTGTCTCTCCTCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010589.5-269s21c1
Sequence:CCGGCCAAGCCACATCTTCTGCATACTCGAGTATGCAGAAGATGTGGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010589.5-1066s21c1
Sequence:CCGGCTGCGACTCCAGGCATTATTTCTCGAGAAATAATGCCTGGAGTCGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000215
JAK3 MISSION shRNA Bacterial Glycerol Stock
Janus kinase 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000215.2-759s1c1
Sequence:CCGGCTCATGGCCAAGTACATCATGCTCGAGCATGATGTACTTGGCCATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000215.x-3709s1c1
Sequence:CCGGCAAAGAAGCAAGGAACCAAATCTCGAGATTTGGTTCCTTGCTTCTTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000215.x-3153s1c1
Sequence:CCGGCTCTTCACCTACTGCGACAAACTCGAGTTTGTCGCAGTAGGTGAAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000215.x-210s1c1
Sequence:CCGGCAGCGCCTATCTTTCTCCTTTCTCGAGAAAGGAGAAAGATAGGCGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000215.x-2285s1c1
Sequence:CCGGTCCTGCTAAGAAACTCCAATTCTCGAGAATTGGAGTTTCTTAGCAGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000215.2-3153s1c1
Sequence:CCGGGCCGAGTTCCTGCGGATGATGCTCGAGCATCATCCGCAGGAACTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000215.2-3623s1c1
Sequence:CCGGGTTCAAGACAGATGGGCATATCTCGAGATATGCCCATCTGTCTTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000215.2-1880s1c1
Sequence:CCGGCATAGACATGTATCTGCGAAACTCGAGTTTCGCAGATACATGTCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000215.2-2689s1c1
Sequence:CCGGCACTGCACAGTGATTTCATTGCTCGAGCAATGAAATCACTGTGCAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000215.2-3047s1c1
Sequence:CCGGCGAATCCCTCTCGGACAACATCTCGAGATGTTGTCCGAGAGGGATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000215
JAK3 MISSION shRNA shRNA Plasmid DNA
Janus kinase 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000215.2-759s1c1
Sequence:CCGGCTCATGGCCAAGTACATCATGCTCGAGCATGATGTACTTGGCCATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000215.x-3709s1c1
Sequence:CCGGCAAAGAAGCAAGGAACCAAATCTCGAGATTTGGTTCCTTGCTTCTTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000215.x-3153s1c1
Sequence:CCGGCTCTTCACCTACTGCGACAAACTCGAGTTTGTCGCAGTAGGTGAAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000215.x-210s1c1
Sequence:CCGGCAGCGCCTATCTTTCTCCTTTCTCGAGAAAGGAGAAAGATAGGCGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000215.x-2285s1c1
Sequence:CCGGTCCTGCTAAGAAACTCCAATTCTCGAGAATTGGAGTTTCTTAGCAGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000215.2-3153s1c1
Sequence:CCGGGCCGAGTTCCTGCGGATGATGCTCGAGCATCATCCGCAGGAACTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000215.2-3623s1c1
Sequence:CCGGGTTCAAGACAGATGGGCATATCTCGAGATATGCCCATCTGTCTTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000215.2-1880s1c1
Sequence:CCGGCATAGACATGTATCTGCGAAACTCGAGTTTCGCAGATACATGTCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000215.2-2689s1c1
Sequence:CCGGCACTGCACAGTGATTTCATTGCTCGAGCAATGAAATCACTGTGCAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000215.2-3047s1c1
Sequence:CCGGCGAATCCCTCTCGGACAACATCTCGAGATGTTGTCCGAGAGGGATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000215
JAK3 MISSION shRNA Lentiviral Transduction Particles
Janus kinase 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000215.2-759s1c1
Sequence:CCGGCTCATGGCCAAGTACATCATGCTCGAGCATGATGTACTTGGCCATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000215.x-3709s1c1
Sequence:CCGGCAAAGAAGCAAGGAACCAAATCTCGAGATTTGGTTCCTTGCTTCTTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000215.x-3153s1c1
Sequence:CCGGCTCTTCACCTACTGCGACAAACTCGAGTTTGTCGCAGTAGGTGAAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000215.x-210s1c1
Sequence:CCGGCAGCGCCTATCTTTCTCCTTTCTCGAGAAAGGAGAAAGATAGGCGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000215.x-2285s1c1
Sequence:CCGGTCCTGCTAAGAAACTCCAATTCTCGAGAATTGGAGTTTCTTAGCAGGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000215.2-3153s1c1
Sequence:CCGGGCCGAGTTCCTGCGGATGATGCTCGAGCATCATCCGCAGGAACTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000215.2-3623s1c1
Sequence:CCGGGTTCAAGACAGATGGGCATATCTCGAGATATGCCCATCTGTCTTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000215.2-1880s1c1
Sequence:CCGGCATAGACATGTATCTGCGAAACTCGAGTTTCGCAGATACATGTCTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000215.2-2689s1c1
Sequence:CCGGCACTGCACAGTGATTTCATTGCTCGAGCAATGAAATCACTGTGCAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000215.2-3047s1c1
Sequence:CCGGCGAATCCCTCTCGGACAACATCTCGAGATGTTGTCCGAGAGGGATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)