EMAIL THIS PAGE TO A FRIEND

JAKMIP2

janus kinase and microtubule interacting protein 2

98 Gene Product Result for
Synonyms: JAMIP2 NECC1
UniProtKB ID: Q96AA8, A4ZZA7, A8K5G5, O60302, Q548S1
Gene ID:
Human(9832) Summary: The protein encoded by this gene is reported to be a component of the Golgi matrix. It may act as a golgin protein by negatively regulating transit of secretory cargo and by acting as a structural scaffold of the Golgi. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Mouse(76217) janus kinase and microtubule interacting protein 2
Rat(307479) janus kinase and microtubule interacting protein 2
Zebrafish(559839) janus kinase and microtubule interacting protein 2
dog(478054) janus kinase and microtubule interacting protein 2
chicken(416352) janus kinase and microtubule interacting protein 2
cow(527239) janus kinase and microtubule interacting protein 2
Horse(100060922) janus kinase and microtubule interacting protein 2
domestic cat(101085344) janus kinase and microtubule interacting protein 2
domestic guinea pig(100718527) janus kinase and microtubule interacting protein 2
naked mole-rat(101703503) janus kinase and microtubule interacting protein 2
sheep(101115029) janus kinase and microtubule interacting protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001163637 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001163637 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001163637 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014790 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014790 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014790 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014790 Rosetta Predictions human pricing
NM_001107391 Rosetta Predictions rat pricing
XM_129010 Rosetta Predictions mouse pricing
XM_922928 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014790 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134150 predicted 2700
2 SASI_Hs02_00346292 predicted 1636
3 SASI_Hs01_00134152 predicted 1362
4 SASI_Hs01_00134154 predicted 378
5 SASI_Hs01_00134156 predicted 1881
6 SASI_Hs01_00134157 predicted 2816
7 SASI_Hs01_00134158 predicted 2133
8 SASI_Hs02_00346293 predicted 1841
9 SASI_Hs02_00346294 predicted 1234
10 SASI_Hs02_00346295 predicted 1589
11 SASI_Hs01_00134151 predicted 2264
12 SASI_Hs01_00134153 predicted 2282
13 SASI_Hs01_00134155 predicted 2225
14 SASI_Hs01_00134159 predicted 2507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107391 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228355 predicted 2335
2 SASI_Rn02_00228356 predicted 366
3 SASI_Rn02_00228357 predicted 786
4 SASI_Rn02_00228358 predicted 1701
5 SASI_Rn02_00228359 predicted 2881
6 SASI_Rn02_00228360 predicted 2841
7 SASI_Rn02_00228361 predicted 1188
8 SASI_Rn02_00228362 predicted 1748
9 SASI_Rn02_00228363 predicted 2100
10 SASI_Rn02_00228364 predicted 1547
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_129010 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00424297 predicted 3018
2 SASI_Mm01_00210549 predicted 2158
3 SASI_Mm01_00210550 predicted 2350
4 SASI_Mm01_00210551 predicted 2328
5 SASI_Mm01_00210552 predicted 926
6 SASI_Mm01_00210553 predicted 976
7 SASI_Mm02_00424298 predicted 561
8 SASI_Mm01_00210554 predicted 1884
9 SASI_Mm01_00210555 predicted 1897
10 SASI_Mm01_00210556 predicted 1740
11 SASI_Mm01_00210548 predicted 2915
12 SASI_Mm01_00210557 predicted 2420
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_922928 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00443552 predicted 3015
2 SASI_Mm02_00443553 predicted 2164
3 SASI_Mm02_00443554 predicted 2347
4 SASI_Mm02_00443555 predicted 2322
5 SASI_Mm02_00443556 predicted 924
6 SASI_Mm02_00443557 predicted 980
7 SASI_Mm02_00443558 predicted 557
8 SASI_Mm02_00443559 predicted 1884
9 SASI_Mm02_00443560 predicted 1895
10 SASI_Mm02_00443561 predicted 1740
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163637
JAKMIP2 MISSION shRNA Bacterial Glycerol Stock
janus kinase and microtubule interacting protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163637.1-3069s21c1
Sequence:CCGGGCCAAGACTATGTGCTTTAAACTCGAGTTTAAAGCACATAGTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163637.1-1070s21c1
Sequence:CCGGGGGAATCCGAACGGGATATACCTCGAGGTATATCCCGTTCGGATTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163637.1-2592s21c1
Sequence:CCGGGGCTCTTGACCAGGCATATATCTCGAGATATATGCCTGGTCAAGAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163637.1-1887s21c1
Sequence:CCGGAGAATCTGAGCTACGATTTAGCTCGAGCTAAATCGTAGCTCAGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163637.1-673s21c1
Sequence:CCGGGTCCTGGTGACCGAGCTTAAACTCGAGTTTAAGCTCGGTCACCAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163637
JAKMIP2 MISSION shRNA shRNA Plasmid DNA
janus kinase and microtubule interacting protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163637.1-3069s21c1
Sequence:CCGGGCCAAGACTATGTGCTTTAAACTCGAGTTTAAAGCACATAGTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163637.1-1070s21c1
Sequence:CCGGGGGAATCCGAACGGGATATACCTCGAGGTATATCCCGTTCGGATTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163637.1-2592s21c1
Sequence:CCGGGGCTCTTGACCAGGCATATATCTCGAGATATATGCCTGGTCAAGAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163637.1-1887s21c1
Sequence:CCGGAGAATCTGAGCTACGATTTAGCTCGAGCTAAATCGTAGCTCAGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163637.1-673s21c1
Sequence:CCGGGTCCTGGTGACCGAGCTTAAACTCGAGTTTAAGCTCGGTCACCAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163637
JAKMIP2 MISSION shRNA Lentiviral Transduction Particles
janus kinase and microtubule interacting protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163637.1-3069s21c1
Sequence:CCGGGCCAAGACTATGTGCTTTAAACTCGAGTTTAAAGCACATAGTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163637.1-1070s21c1
Sequence:CCGGGGGAATCCGAACGGGATATACCTCGAGGTATATCCCGTTCGGATTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163637.1-2592s21c1
Sequence:CCGGGGCTCTTGACCAGGCATATATCTCGAGATATATGCCTGGTCAAGAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163637.1-1887s21c1
Sequence:CCGGAGAATCTGAGCTACGATTTAGCTCGAGCTAAATCGTAGCTCAGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163637.1-673s21c1
Sequence:CCGGGTCCTGGTGACCGAGCTTAAACTCGAGTTTAAGCTCGGTCACCAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014790
JAKMIP2 MISSION shRNA Bacterial Glycerol Stock
janus kinase and microtubule interacting protein 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014790.3-2503s21c1
Sequence:GTACCGGAGCTCTTGACCAAGCATATATCTCGAGATATATGCTTGGTCAAGAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014790.3-2989s21c1
Sequence:CCGGCTACAATATATGCTGCATTTACTCGAGTAAATGCAGCATATATTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014790.3-1804s21c1
Sequence:CCGGTGAACTAAGATTTCGACAATTCTCGAGAATTGTCGAAATCTTAGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014790.3-1643s21c1
Sequence:CCGGAGAAGTTCCAAGCCAATTAAGCTCGAGCTTAATTGGCTTGGAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014790.3-1214s21c1
Sequence:CCGGAGTCCTGATTTGCGAAGAAATCTCGAGATTTCTTCGCAAATCAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014790.3-1212s1c1
Sequence:CCGGGCAGTCCTGATTTGCGAAGAACTCGAGTTCTTCGCAAATCAGGACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172682    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014790.3-2909s1c1
Sequence:CCGGGCCAGGACTACAACTGTGTATCTCGAGATACACAGTTGTAGTCCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014790
JAKMIP2 MISSION shRNA shRNA Plasmid DNA
janus kinase and microtubule interacting protein 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014790.3-2503s21c1
Sequence:GTACCGGAGCTCTTGACCAAGCATATATCTCGAGATATATGCTTGGTCAAGAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014790.3-2989s21c1
Sequence:CCGGCTACAATATATGCTGCATTTACTCGAGTAAATGCAGCATATATTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014790.3-1804s21c1
Sequence:CCGGTGAACTAAGATTTCGACAATTCTCGAGAATTGTCGAAATCTTAGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014790.3-1643s21c1
Sequence:CCGGAGAAGTTCCAAGCCAATTAAGCTCGAGCTTAATTGGCTTGGAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014790.3-1214s21c1
Sequence:CCGGAGTCCTGATTTGCGAAGAAATCTCGAGATTTCTTCGCAAATCAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014790.3-1212s1c1
Sequence:CCGGGCAGTCCTGATTTGCGAAGAACTCGAGTTCTTCGCAAATCAGGACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172682    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014790.3-2909s1c1
Sequence:CCGGGCCAGGACTACAACTGTGTATCTCGAGATACACAGTTGTAGTCCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014790
JAKMIP2 MISSION shRNA Lentiviral Transduction Particles
janus kinase and microtubule interacting protein 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014790.3-2503s21c1
Sequence:GTACCGGAGCTCTTGACCAAGCATATATCTCGAGATATATGCTTGGTCAAGAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014790.3-2989s21c1
Sequence:CCGGCTACAATATATGCTGCATTTACTCGAGTAAATGCAGCATATATTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014790.3-1804s21c1
Sequence:CCGGTGAACTAAGATTTCGACAATTCTCGAGAATTGTCGAAATCTTAGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014790.3-1643s21c1
Sequence:CCGGAGAAGTTCCAAGCCAATTAAGCTCGAGCTTAATTGGCTTGGAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014790.3-1214s21c1
Sequence:CCGGAGTCCTGATTTGCGAAGAAATCTCGAGATTTCTTCGCAAATCAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014790.3-1212s1c1
Sequence:CCGGGCAGTCCTGATTTGCGAAGAACTCGAGTTCTTCGCAAATCAGGACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172682    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014790.3-2909s1c1
Sequence:CCGGGCCAGGACTACAACTGTGTATCTCGAGATACACAGTTGTAGTCCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)