EMAIL THIS PAGE TO A FRIEND

JAKMIP3

Janus kinase and microtubule interacting protein 3

73 Gene Product Result for
Synonyms: C10orf14 C10orf39 Jamip3 NECC2 bA140A10.5
UniProtKB ID: Q5VZ66, A6PW00, Q69YM6, Q6ZT29
Gene ID:
Mouse(74004) janus kinase and microtubule interacting protein 3
Rat(365380) janus kinase and microtubule interacting protein 3
Zebrafish(555987) Janus kinase and microtubule interacting protein 3
cow(614810) Janus kinase and microtubule interacting protein 3
Horse(100051599) Janus kinase and microtubule interacting protein 3
domestic cat(101082781) Janus kinase and microtubule interacting protein 3
chicken(428991) Janus kinase and microtubule interacting protein 3
sheep(101108708) Janus kinase and microtubule interacting protein 3
domestic guinea pig(100730144) Janus kinase and microtubule interacting protein 3
naked mole-rat(101708835) Janus kinase and microtubule interacting protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194303 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194303 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194303 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028708 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028708 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028708 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105521 Rosetta Predictions human pricing
NM_194303 Rosetta Predictions human pricing
XM_001057645 Rosetta Predictions rat pricing
XM_344969 Rosetta Predictions rat pricing
XM_355952 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105521 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324189 predicted 585
2 SASI_Hs02_00324190 predicted 841
3 SASI_Hs02_00324191 predicted 1143
4 SASI_Hs02_00324192 predicted 991
5 SASI_Hs02_00324193 predicted 1044
6 SASI_Hs02_00324194 predicted 1223
7 SASI_Hs02_00324195 predicted 2007
8 SASI_Hs02_00324196 predicted 911
9 SASI_Hs02_00324197 predicted 545
10 SASI_Hs02_00324198 predicted 1746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194303 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017764 predicted 545
2 SASI_Hs01_00017765 predicted 435
3 SASI_Hs01_00017766 predicted 1449
4 SASI_Hs01_00017767 predicted 371
5 SASI_Hs01_00017768 predicted 282
6 SASI_Hs01_00017769 predicted 960
7 SASI_Hs01_00017770 predicted 569
8 SASI_Hs01_00017771 predicted 1167
9 SASI_Hs01_00017772 predicted 524
10 SASI_Hs01_00017773 predicted 505
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057645 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00287051 predicted 433
2 SASI_Rn02_00287052 predicted 1484
3 SASI_Rn02_00287053 predicted 1188
4 SASI_Rn02_00287054 predicted 1486
5 SASI_Rn02_00287055 predicted 1417
6 SASI_Rn02_00287056 predicted 1518
7 SASI_Rn02_00287057 predicted 1515
8 SASI_Rn02_00287058 predicted 576
9 SASI_Rn02_00287059 predicted 707
10 SASI_Rn02_00287060 predicted 1480
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344969 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00150195 predicted 1024
2 SASI_Rn01_00150196 predicted 1251
3 SASI_Rn01_00150197 predicted 489
4 SASI_Rn01_00150198 predicted 742
5 SASI_Rn01_00150199 predicted 1466
6 SASI_Rn01_00150200 predicted 1369
7 SASI_Rn01_00150201 predicted 771
8 SASI_Rn01_00150202 predicted 1462
9 SASI_Rn01_00150203 predicted 1151
10 SASI_Rn01_00150204 predicted 643
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355952 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00425890 predicted 1442
2 SASI_Mm02_00425891 predicted 449
3 SASI_Mm02_00425892 predicted 1330
4 SASI_Mm02_00425893 predicted 1216
5 SASI_Mm02_00425894 predicted 1396
6 SASI_Mm02_00425895 predicted 1295
7 SASI_Mm02_00425896 predicted 1365
8 SASI_Mm02_00425897 predicted 524
9 SASI_Mm02_00425898 predicted 454
10 SASI_Mm02_00425899 predicted 1433
11 SASI_Mm01_00238947 predicted 455
12 SASI_Mm01_00238948 predicted 453
13 SASI_Mm01_00238949 predicted 304
14 SASI_Mm01_00238950 predicted 335
15 SASI_Mm01_00238951 predicted 536
16 SASI_Mm01_00238952 predicted 319
17 SASI_Mm01_00238953 predicted 600
18 SASI_Mm01_00238954 predicted 327
19 SASI_Mm01_00238955 predicted 393
20 SASI_Mm01_00238956 predicted 324
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194303
JAKMIP3 MISSION shRNA Bacterial Glycerol Stock
Janus kinase and microtubule interacting protein 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194303.1-484s1c1
Sequence:CCGGGCTGATGAAGAAGCTGGACATCTCGAGATGTCCAGCTTCTTCATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194303.1-1029s1c1
Sequence:CCGGCCTTAGCTTTCATTCTCTGGTCTCGAGACCAGAGAATGAAAGCTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194303.1-926s1c1
Sequence:CCGGCTGGCTCAGCAGAGAATTAAACTCGAGTTTAATTCTCTGCTGAGCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134302    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194303.1-4242s1c1
Sequence:CCGGGCCAGAAATGTACTGTTACATCTCGAGATGTAACAGTACATTTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194303.1-3177s1c1
Sequence:CCGGCCTGATTTACTCGGCAAGATACTCGAGTATCTTGCCGAGTAAATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194303
JAKMIP3 MISSION shRNA shRNA Plasmid DNA
Janus kinase and microtubule interacting protein 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194303.1-484s1c1
Sequence:CCGGGCTGATGAAGAAGCTGGACATCTCGAGATGTCCAGCTTCTTCATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194303.1-1029s1c1
Sequence:CCGGCCTTAGCTTTCATTCTCTGGTCTCGAGACCAGAGAATGAAAGCTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194303.1-926s1c1
Sequence:CCGGCTGGCTCAGCAGAGAATTAAACTCGAGTTTAATTCTCTGCTGAGCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134302    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194303.1-4242s1c1
Sequence:CCGGGCCAGAAATGTACTGTTACATCTCGAGATGTAACAGTACATTTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194303.1-3177s1c1
Sequence:CCGGCCTGATTTACTCGGCAAGATACTCGAGTATCTTGCCGAGTAAATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194303
JAKMIP3 MISSION shRNA Lentiviral Transduction Particles
Janus kinase and microtubule interacting protein 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194303.1-484s1c1
Sequence:CCGGGCTGATGAAGAAGCTGGACATCTCGAGATGTCCAGCTTCTTCATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194303.1-1029s1c1
Sequence:CCGGCCTTAGCTTTCATTCTCTGGTCTCGAGACCAGAGAATGAAAGCTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194303.1-926s1c1
Sequence:CCGGCTGGCTCAGCAGAGAATTAAACTCGAGTTTAATTCTCTGCTGAGCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134302    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194303.1-4242s1c1
Sequence:CCGGGCCAGAAATGTACTGTTACATCTCGAGATGTAACAGTACATTTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194303.1-3177s1c1
Sequence:CCGGCCTGATTTACTCGGCAAGATACTCGAGTATCTTGCCGAGTAAATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028708
JAKMIP3 MISSION shRNA Bacterial Glycerol Stock
Janus kinase and microtubule interacting protein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028708.1-1434s21c1
Sequence:CCGGGAGTGTGTTGGAGCGTGATAACTCGAGTTATCACGCTCCAACACACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342076    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028708.1-2991s21c1
Sequence:CCGGCCAATCACACCAATGTGTAATCTCGAGATTACACATTGGTGTGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028708.1-790s21c1
Sequence:CCGGCTGATGGAGGAGATAAGATTTCTCGAGAAATCTTATCTCCTCCATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028708.1-1033s21c1
Sequence:CCGGGCTAGGCGCTTCCAACTTAAACTCGAGTTTAAGTTGGAAGCGCCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028708.1-1870s21c1
Sequence:CCGGCAAGCACTGTATCGACGAAATCTCGAGATTTCGTCGATACAGTGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028708
JAKMIP3 MISSION shRNA shRNA Plasmid DNA
Janus kinase and microtubule interacting protein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028708.1-1434s21c1
Sequence:CCGGGAGTGTGTTGGAGCGTGATAACTCGAGTTATCACGCTCCAACACACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342076    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028708.1-2991s21c1
Sequence:CCGGCCAATCACACCAATGTGTAATCTCGAGATTACACATTGGTGTGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028708.1-790s21c1
Sequence:CCGGCTGATGGAGGAGATAAGATTTCTCGAGAAATCTTATCTCCTCCATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028708.1-1033s21c1
Sequence:CCGGGCTAGGCGCTTCCAACTTAAACTCGAGTTTAAGTTGGAAGCGCCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028708.1-1870s21c1
Sequence:CCGGCAAGCACTGTATCGACGAAATCTCGAGATTTCGTCGATACAGTGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028708
JAKMIP3 MISSION shRNA Lentiviral Transduction Particles
Janus kinase and microtubule interacting protein 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028708.1-1434s21c1
Sequence:CCGGGAGTGTGTTGGAGCGTGATAACTCGAGTTATCACGCTCCAACACACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342076    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028708.1-2991s21c1
Sequence:CCGGCCAATCACACCAATGTGTAATCTCGAGATTACACATTGGTGTGATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028708.1-790s21c1
Sequence:CCGGCTGATGGAGGAGATAAGATTTCTCGAGAAATCTTATCTCCTCCATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028708.1-1033s21c1
Sequence:CCGGGCTAGGCGCTTCCAACTTAAACTCGAGTTTAAGTTGGAAGCGCCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028708.1-1870s21c1
Sequence:CCGGCAAGCACTGTATCGACGAAATCTCGAGATTTCGTCGATACAGTGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)