EMAIL THIS PAGE TO A FRIEND

JAM2

junctional adhesion molecule 2

76 Gene Product Result for
Synonyms: C21orf43 CD322 JAM-B JAMB PRO245 VE-JAM VEJAM
UniProtKB ID: P57087, B2R6T9, B4DGT9, Q6UXG6, Q6YNC1
Gene ID:
Human(58494) Summary: This gene belongs to the immunoglobulin superfamily, and the junctional adhesion molecule (JAM) family. The protein encoded by this gene is a type I membrane protein that is localized at the tight junctions of both epithelial and endothelial cells. It acts as an adhesive ligand for interacting with a variety of immune cell types, and may play a role in lymphocyte homing to secondary lymphoid organs. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2012]
Mouse(67374) junction adhesion molecule 2
Rat(619374) junctional adhesion molecule 2
chicken(418476) junctional adhesion molecule 2
dog(478392) junctional adhesion molecule 2
cow(538846) junctional adhesion molecule 2
domestic cat(101100907) junctional adhesion molecule 2
domestic guinea pig(100726546) junctional adhesion molecule 2
naked mole-rat(101722148) junctional adhesion molecule 2
sheep(101118411) junctional adhesion molecule 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1541 Human JAM-B ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021219 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021219 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021219 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023844 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023844 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023844 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021219 Rosetta Predictions human pricing
NM_001034004 Rosetta Predictions rat pricing
NM_023844 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021219 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122041 predicted 1252
2 SASI_Hs01_00122042 predicted 1275
3 SASI_Hs01_00122043 predicted 1106
4 SASI_Hs01_00122044 predicted 710
5 SASI_Hs01_00122045 predicted 1229
6 SASI_Hs01_00122046 predicted 1447
7 SASI_Hs01_00122047 predicted 1029
8 SASI_Hs01_00122048 predicted 1377
9 SASI_Hs01_00122049 predicted 1299
10 SASI_Hs02_00354832 predicted 1294
11 SASI_Hs01_00122040 predicted 709
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034004 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117305 predicted 260
2 SASI_Rn01_00117307 predicted 983
3 SASI_Rn02_00203880 predicted 1073
4 SASI_Rn01_00117308 predicted 643
5 SASI_Rn01_00117309 predicted 573
6 SASI_Rn01_00117310 predicted 212
7 SASI_Rn01_00117311 predicted 1081
8 SASI_Rn01_00117312 predicted 864
9 SASI_Rn01_00117313 predicted 1103
10 SASI_Rn01_00117314 predicted 414
11 SASI_Rn01_00117306 predicted 870
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023844 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327393 predicted 817
2 SASI_Mm01_00065833 predicted 911
3 SASI_Mm02_00327394 predicted 729
4 SASI_Mm02_00327395 predicted 468
5 SASI_Mm02_00327396 predicted 915
6 SASI_Mm02_00327397 predicted 854
7 SASI_Mm02_00327398 predicted 715
8 SASI_Mm01_00065838 predicted 1044
9 SASI_Mm02_00327399 predicted 1038
10 SASI_Mm02_00327400 predicted 943
11 SASI_Mm01_00065829 predicted 890
12 SASI_Mm01_00065830 predicted 988
13 SASI_Mm01_00065831 predicted 647
14 SASI_Mm01_00065832 predicted 901
15 SASI_Mm01_00065834 predicted 1041
16 SASI_Mm01_00065835 predicted 369
17 SASI_Mm01_00065836 predicted 1022
18 SASI_Mm01_00065837 predicted 471
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021219
JAM2 MISSION shRNA Bacterial Glycerol Stock
junctional adhesion molecule 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021219.2-1472s21c1
Sequence:CCGGACCGTTGTTACACAAGTTATTCTCGAGAATAACTTGTGTAACAACGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021219.2-667s21c1
Sequence:CCGGTAGAGTACCAAGAGGCTATTTCTCGAGAAATAGCCTCTTGGTACTCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021219.2-1380s21c1
Sequence:CCGGTCATCTAAAGCCACGACAATGCTCGAGCATTGTCGTGGCTTTAGATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021219.2-1506s21c1
Sequence:CCGGACTCTGCTTTGTCCGACATTTCTCGAGAAATGTCGGACAAAGCAGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021219.2-1032s1c1
Sequence:CCGGGCTCCTGAATACACATGGTTTCTCGAGAAACCATGTGTATTCAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021219.2-707s1c1
Sequence:CCGGGAAGACTGTTTCCTCCAGATTCTCGAGAATCTGGAGGAAACAGTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021219.2-1326s1c1
Sequence:CCGGGCTCAGAGGAAAGGCTACTTTCTCGAGAAAGTAGCCTTTCCTCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021219.2-1108s1c1
Sequence:CCGGGCTCATACACAATGAATACAACTCGAGTTGTATTCATTGTGTATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021219.2-804s1c1
Sequence:CCGGGCTGAGATGATAGATTTCAATCTCGAGATTGAAATCTATCATCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021219
JAM2 MISSION shRNA shRNA Plasmid DNA
junctional adhesion molecule 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021219.2-1472s21c1
Sequence:CCGGACCGTTGTTACACAAGTTATTCTCGAGAATAACTTGTGTAACAACGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021219.2-667s21c1
Sequence:CCGGTAGAGTACCAAGAGGCTATTTCTCGAGAAATAGCCTCTTGGTACTCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021219.2-1380s21c1
Sequence:CCGGTCATCTAAAGCCACGACAATGCTCGAGCATTGTCGTGGCTTTAGATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021219.2-1506s21c1
Sequence:CCGGACTCTGCTTTGTCCGACATTTCTCGAGAAATGTCGGACAAAGCAGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021219.2-1032s1c1
Sequence:CCGGGCTCCTGAATACACATGGTTTCTCGAGAAACCATGTGTATTCAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021219.2-707s1c1
Sequence:CCGGGAAGACTGTTTCCTCCAGATTCTCGAGAATCTGGAGGAAACAGTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021219.2-1326s1c1
Sequence:CCGGGCTCAGAGGAAAGGCTACTTTCTCGAGAAAGTAGCCTTTCCTCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021219.2-1108s1c1
Sequence:CCGGGCTCATACACAATGAATACAACTCGAGTTGTATTCATTGTGTATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021219.2-804s1c1
Sequence:CCGGGCTGAGATGATAGATTTCAATCTCGAGATTGAAATCTATCATCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021219
JAM2 MISSION shRNA Lentiviral Transduction Particles
junctional adhesion molecule 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021219.2-1472s21c1
Sequence:CCGGACCGTTGTTACACAAGTTATTCTCGAGAATAACTTGTGTAACAACGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021219.2-667s21c1
Sequence:CCGGTAGAGTACCAAGAGGCTATTTCTCGAGAAATAGCCTCTTGGTACTCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021219.2-1380s21c1
Sequence:CCGGTCATCTAAAGCCACGACAATGCTCGAGCATTGTCGTGGCTTTAGATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021219.2-1506s21c1
Sequence:CCGGACTCTGCTTTGTCCGACATTTCTCGAGAAATGTCGGACAAAGCAGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021219.2-1032s1c1
Sequence:CCGGGCTCCTGAATACACATGGTTTCTCGAGAAACCATGTGTATTCAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021219.2-707s1c1
Sequence:CCGGGAAGACTGTTTCCTCCAGATTCTCGAGAATCTGGAGGAAACAGTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021219.2-1326s1c1
Sequence:CCGGGCTCAGAGGAAAGGCTACTTTCTCGAGAAAGTAGCCTTTCCTCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021219.2-1108s1c1
Sequence:CCGGGCTCATACACAATGAATACAACTCGAGTTGTATTCATTGTGTATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021219.2-804s1c1
Sequence:CCGGGCTGAGATGATAGATTTCAATCTCGAGATTGAAATCTATCATCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023844
VALIDATED
JAM2 MISSION shRNA Bacterial Glycerol Stock
junctional adhesion molecule 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000366258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023844.4-418s21c1
Sequence:CCGGCGTCGCCCTGGACTATCATAACTCGAGTTATGATAGTCCAGGGCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023844.4-1057s21c1
Sequence:CCGGAGTAGATGTTCTCAACATAAGCTCGAGCTTATGTTGAGAACATCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023844.4-622s21c1
Sequence:CCGGCCGTGCTGAGATGATAGATTTCTCGAGAAATCTATCATCTCAGCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023844.4-820s21c1
Sequence:CCGGGGAGCTACGATGCCAGGATAACTCGAGTTATCCTGGCATCGTAGCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023844.4-983s21c1
Sequence:CCGGATGGACAGTGGAGAGTATTACCTCGAGGTAATACTCTCCACTGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023844.4-1098s21c1
Sequence:CCGGTGGTGGTGGCCTTCGTGATTTCTCGAGAAATCACGAAGGCCACCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023844.2-2743s1c1
Sequence:CCGGGCCATGCAGAAATCATTGTATCTCGAGATACAATGATTTCTGCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023844.2-548s1c1
Sequence:CCGGCCGGAGTACATCTGGTTTAAACTCGAGTTTAAACCAGATGTACTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023844.2-114s1c1
Sequence:CCGGCCCTGGACTATCATAAGGCAACTCGAGTTGCCTTATGATAGTCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023844.2-161s1c1
Sequence:CCGGCGTCAAGAAGTCACAGTAATACTCGAGTATTACTGTGACTTCTTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023844.2-652s1c1
Sequence:CCGGGCAATTCAACATGATTTCCAACTCGAGTTGGAAATCATGTTGAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023844
VALIDATED
JAM2 MISSION shRNA shRNA Plasmid DNA
junctional adhesion molecule 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000366258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023844.4-418s21c1
Sequence:CCGGCGTCGCCCTGGACTATCATAACTCGAGTTATGATAGTCCAGGGCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023844.4-1057s21c1
Sequence:CCGGAGTAGATGTTCTCAACATAAGCTCGAGCTTATGTTGAGAACATCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023844.4-622s21c1
Sequence:CCGGCCGTGCTGAGATGATAGATTTCTCGAGAAATCTATCATCTCAGCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023844.4-820s21c1
Sequence:CCGGGGAGCTACGATGCCAGGATAACTCGAGTTATCCTGGCATCGTAGCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023844.4-983s21c1
Sequence:CCGGATGGACAGTGGAGAGTATTACCTCGAGGTAATACTCTCCACTGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023844.4-1098s21c1
Sequence:CCGGTGGTGGTGGCCTTCGTGATTTCTCGAGAAATCACGAAGGCCACCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023844.2-2743s1c1
Sequence:CCGGGCCATGCAGAAATCATTGTATCTCGAGATACAATGATTTCTGCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023844.2-548s1c1
Sequence:CCGGCCGGAGTACATCTGGTTTAAACTCGAGTTTAAACCAGATGTACTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023844.2-114s1c1
Sequence:CCGGCCCTGGACTATCATAAGGCAACTCGAGTTGCCTTATGATAGTCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023844.2-161s1c1
Sequence:CCGGCGTCAAGAAGTCACAGTAATACTCGAGTATTACTGTGACTTCTTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023844.2-652s1c1
Sequence:CCGGGCAATTCAACATGATTTCCAACTCGAGTTGGAAATCATGTTGAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023844
VALIDATED
JAM2 MISSION shRNA Lentiviral Transduction Particles
junctional adhesion molecule 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000366258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023844.4-418s21c1
Sequence:CCGGCGTCGCCCTGGACTATCATAACTCGAGTTATGATAGTCCAGGGCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023844.4-1057s21c1
Sequence:CCGGAGTAGATGTTCTCAACATAAGCTCGAGCTTATGTTGAGAACATCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023844.4-622s21c1
Sequence:CCGGCCGTGCTGAGATGATAGATTTCTCGAGAAATCTATCATCTCAGCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023844.4-820s21c1
Sequence:CCGGGGAGCTACGATGCCAGGATAACTCGAGTTATCCTGGCATCGTAGCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023844.4-983s21c1
Sequence:CCGGATGGACAGTGGAGAGTATTACCTCGAGGTAATACTCTCCACTGTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023844.4-1098s21c1
Sequence:CCGGTGGTGGTGGCCTTCGTGATTTCTCGAGAAATCACGAAGGCCACCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023844.2-2743s1c1
Sequence:CCGGGCCATGCAGAAATCATTGTATCTCGAGATACAATGATTTCTGCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023844.2-548s1c1
Sequence:CCGGCCGGAGTACATCTGGTTTAAACTCGAGTTTAAACCAGATGTACTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023844.2-114s1c1
Sequence:CCGGCCCTGGACTATCATAAGGCAACTCGAGTTGCCTTATGATAGTCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023844.2-161s1c1
Sequence:CCGGCGTCAAGAAGTCACAGTAATACTCGAGTATTACTGTGACTTCTTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023844.2-652s1c1
Sequence:CCGGGCAATTCAACATGATTTCCAACTCGAGTTGGAAATCATGTTGAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)